Incidental Mutation 'R0732:Ddhd2'
ID67657
Institutional Source Beutler Lab
Gene Symbol Ddhd2
Ensembl Gene ENSMUSG00000061313
Gene NameDDHD domain containing 2
Synonyms2010305K11Rik, SAMWD1
MMRRC Submission 038913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0732 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25725346-25754596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25741321 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 364 (Q364R)
Ref Sequence ENSEMBL: ENSMUSP00000033975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000211009] [ENSMUST00000211688]
Predicted Effect probably damaging
Transcript: ENSMUST00000033975
AA Change: Q364R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313
AA Change: Q364R

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210843
Predicted Effect probably benign
Transcript: ENSMUST00000211009
Predicted Effect probably damaging
Transcript: ENSMUST00000211688
AA Change: Q476R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme containing sterile-alpha-motif (SAM), WWE, and DDHD domains. This protein participates in membrane trafficking between the endoplastic reticulum and the Golgi body. Mutations in this gene can cause autosomal recessive spastic paraplegia 54. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a null mutation display impaired balance and coordination, impaired spatial learning and memory and triglyceride accumulation in neurons in the brain and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,546,448 Y1175C probably damaging Het
Acsm3 T C 7: 119,773,834 S187P probably benign Het
Adam28 T C 14: 68,637,347 I294V probably benign Het
Adgrv1 T C 13: 81,503,004 I3057M possibly damaging Het
Aff4 T C 11: 53,375,596 V304A probably benign Het
Akr1b10 T C 6: 34,390,109 Y108H probably benign Het
Ankib1 T C 5: 3,713,163 N522S possibly damaging Het
Ano1 T A 7: 144,619,488 probably null Het
Antxr2 G T 5: 97,960,708 probably null Het
Arc G A 15: 74,671,195 T393I probably damaging Het
Arhgef33 A G 17: 80,381,354 D5G possibly damaging Het
Atf2 A T 2: 73,845,500 M169K possibly damaging Het
BC005624 T A 2: 30,973,937 T215S possibly damaging Het
BC048403 T C 10: 121,750,947 V253A possibly damaging Het
Bmp8b G A 4: 123,105,406 G19D unknown Het
Cacna1d T C 14: 30,042,920 N1987S probably damaging Het
Camta1 T A 4: 151,586,484 probably null Het
Catsperg2 C T 7: 29,700,696 G316D probably damaging Het
Cbs G T 17: 31,625,029 N209K probably benign Het
Ccdc122 T A 14: 77,091,759 M84K probably damaging Het
Cd5 C T 19: 10,723,285 C285Y probably damaging Het
Chpf2 T C 5: 24,590,421 M1T probably null Het
Coch T A 12: 51,595,372 D42E probably damaging Het
Crip2 C T 12: 113,140,558 probably benign Het
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Cxcl16 G T 11: 70,455,408 P233H probably damaging Het
Cyfip1 T C 7: 55,886,781 I319T probably damaging Het
Ephx2 A G 14: 66,086,963 probably null Het
Exoc6b C A 6: 84,855,522 V397L probably damaging Het
Fam83b T A 9: 76,492,928 K298* probably null Het
Fbxo8 T A 8: 56,591,529 I289N probably damaging Het
Fkbp9 T A 6: 56,878,104 M536K probably benign Het
Flot1 C T 17: 35,825,524 R190W possibly damaging Het
Gbp2b T A 3: 142,606,978 V374E probably benign Het
Gm884 T C 11: 103,619,838 T435A unknown Het
Gna15 T A 10: 81,512,556 S114C probably damaging Het
Gstt4 T A 10: 75,817,321 T136S probably benign Het
Hcn3 C T 3: 89,148,786 V524M probably damaging Het
Kctd16 A T 18: 40,258,563 D68V probably damaging Het
Krt90 G T 15: 101,560,425 F227L possibly damaging Het
Maip1 A G 1: 57,411,835 Y212C probably damaging Het
Mamdc2 C T 19: 23,378,869 D72N probably damaging Het
Marveld3 A T 8: 109,948,483 Y234N probably damaging Het
Mas1 A G 17: 12,841,747 I263T probably benign Het
Matk T A 10: 81,258,306 probably null Het
Mrgpre T A 7: 143,781,566 I67F possibly damaging Het
Mthfd1 T A 12: 76,294,174 I449N probably damaging Het
Nacc1 C T 8: 84,676,201 R321Q probably damaging Het
Neb T C 2: 52,258,681 D2618G probably damaging Het
Neb T C 2: 52,291,268 Y1109C probably damaging Het
Nell1 T G 7: 50,856,387 W781G probably damaging Het
Olfr1037 A C 2: 86,085,584 S64R probably benign Het
Olfr1269 A G 2: 90,119,322 V92A probably benign Het
Olfr1279 T A 2: 111,306,980 Y258* probably null Het
Olfr281 T C 15: 98,457,078 L256S possibly damaging Het
Olfr424 A T 1: 174,137,415 I224F possibly damaging Het
Olfr497 C A 7: 108,422,577 A2D probably benign Het
Olfr544 T C 7: 102,484,443 I226V probably benign Het
Olfr646 T C 7: 104,106,294 L5P probably damaging Het
Pcdh7 C A 5: 57,721,315 D737E probably damaging Het
Pdss1 T G 2: 22,901,312 M55R probably benign Het
Pex6 C T 17: 46,724,700 R889W probably damaging Het
Pigl T A 11: 62,458,481 C8S possibly damaging Het
Plekha7 A T 7: 116,145,237 M585K probably damaging Het
Ppp1r1a C T 15: 103,533,087 M66I possibly damaging Het
Ptcd3 A T 6: 71,881,171 probably benign Het
Rhov A T 2: 119,271,014 V37E probably damaging Het
Rnf213 A T 11: 119,441,068 M2368L probably damaging Het
Skida1 T C 2: 18,046,157 probably benign Het
Slc25a28 T C 19: 43,666,953 D161G probably benign Het
Smc6 T C 12: 11,290,817 V490A probably damaging Het
Sohlh2 T A 3: 55,190,373 probably null Het
Stk31 A G 6: 49,417,495 T264A probably benign Het
Syngap1 T A 17: 26,954,988 S190R possibly damaging Het
Tacr1 T A 6: 82,552,901 V200E probably damaging Het
Tbrg4 C T 11: 6,620,812 R220H probably benign Het
Tcf20 A G 15: 82,852,303 L1649P probably benign Het
Tcirg1 A T 19: 3,897,866 L523Q possibly damaging Het
Tinag T A 9: 77,001,654 K335M possibly damaging Het
Tkt T G 14: 30,571,140 probably null Het
Tnpo1 C T 13: 98,863,812 R349H probably damaging Het
Trim26 T A 17: 36,852,618 S230R possibly damaging Het
Trim8 T A 19: 46,514,739 probably null Het
Trp53bp1 T C 2: 121,248,264 R326G probably null Het
Ugt2a2 A T 5: 87,460,639 I613N probably damaging Het
Vmn1r32 T C 6: 66,553,706 I29V probably benign Het
Wnt5b C T 6: 119,446,582 W27* probably null Het
Other mutations in Ddhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Ddhd2 APN 8 25735830 missense probably damaging 1.00
IGL01629:Ddhd2 APN 8 25735828 missense possibly damaging 0.91
IGL01656:Ddhd2 APN 8 25727712 missense probably benign 0.34
IGL01723:Ddhd2 APN 8 25735011 nonsense probably null
IGL01820:Ddhd2 APN 8 25749754 missense possibly damaging 0.87
IGL01901:Ddhd2 APN 8 25748594 missense probably damaging 0.96
IGL02619:Ddhd2 APN 8 25746954 critical splice acceptor site probably null
PIT4362001:Ddhd2 UTSW 8 25735752 missense probably damaging 1.00
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0408:Ddhd2 UTSW 8 25739587 critical splice acceptor site probably null
R1483:Ddhd2 UTSW 8 25753128 missense probably benign 0.01
R1597:Ddhd2 UTSW 8 25749741 missense probably benign 0.09
R1881:Ddhd2 UTSW 8 25727700 missense probably damaging 0.99
R1927:Ddhd2 UTSW 8 25741661 missense possibly damaging 0.92
R2044:Ddhd2 UTSW 8 25752165 missense probably damaging 1.00
R4494:Ddhd2 UTSW 8 25738234 missense probably benign 0.01
R4728:Ddhd2 UTSW 8 25752267 missense probably damaging 1.00
R5044:Ddhd2 UTSW 8 25752137 missense probably damaging 1.00
R5138:Ddhd2 UTSW 8 25727699 missense probably damaging 1.00
R5529:Ddhd2 UTSW 8 25739560 missense probably benign 0.00
R5761:Ddhd2 UTSW 8 25741699 missense probably benign 0.19
R5799:Ddhd2 UTSW 8 25748602 missense probably damaging 1.00
R5934:Ddhd2 UTSW 8 25753113 missense probably damaging 1.00
R5965:Ddhd2 UTSW 8 25735777 missense probably damaging 1.00
R5988:Ddhd2 UTSW 8 25748562 missense probably damaging 1.00
R6260:Ddhd2 UTSW 8 25752117 missense probably benign 0.00
R6791:Ddhd2 UTSW 8 25752215 missense probably benign 0.04
R7386:Ddhd2 UTSW 8 25754290 missense possibly damaging 0.53
R7470:Ddhd2 UTSW 8 25735060 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTTCTAGCACGCAAGAATGGCAAG -3'
(R):5'- TGTAGCCAGAGAGGACAATCGCAC -3'

Sequencing Primer
(F):5'- GGCATAATTACCAGGCTGTTAC -3'
(R):5'- CGCACTATGAAATGCAGTGTCTC -3'
Posted On2013-09-03