Incidental Mutation 'R0735:Xab2'
ID68233
Institutional Source Beutler Lab
Gene Symbol Xab2
Ensembl Gene ENSMUSG00000019470
Gene NameXPA binding protein 2
Synonyms0610041O14Rik
MMRRC Submission 038916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0735 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3608421-3621316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3613649 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 394 (P394S)
Ref Sequence ENSEMBL: ENSMUSP00000019614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000057028] [ENSMUST00000159235] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019614
AA Change: P394S

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470
AA Change: P394S

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057028
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122654
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably benign
Transcript: ENSMUST00000171962
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably benign
Transcript: ENSMUST00000207432
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably benign
Transcript: ENSMUST00000207970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 91.8%
Validation Efficiency 95% (73/77)
MGI Phenotype PHENOTYPE: Homozygous null embryos die by the blastocyst stage (E3.5) and some eight-cell stage embryos do not undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,717,638 I1552K possibly damaging Het
Actr8 T A 14: 29,989,712 M405K probably benign Het
Adam10 G A 9: 70,748,251 V334I possibly damaging Het
Adgra2 G T 8: 27,117,318 G686C probably damaging Het
Akap11 A T 14: 78,510,078 I1623N probably damaging Het
Astn1 A T 1: 158,472,389 T100S possibly damaging Het
B3galt1 A C 2: 68,118,579 I213L possibly damaging Het
B4galnt4 A G 7: 141,064,323 K101E probably benign Het
Camsap2 A G 1: 136,292,888 S324P probably damaging Het
Chrnb4 A G 9: 55,043,800 S60P probably damaging Het
Cpne1 A G 2: 156,078,750 probably null Het
Cubn G A 2: 13,491,689 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cxcl15 T C 5: 90,801,294 M106T probably benign Het
Cyp2c23 A T 19: 44,016,810 M140K probably damaging Het
Dgke A G 11: 89,060,075 F104S probably benign Het
Dhx36 T A 3: 62,472,729 M849L probably benign Het
Dnah7a C T 1: 53,544,511 E1522K possibly damaging Het
Edil3 G T 13: 89,177,178 V219F probably damaging Het
Egln1 A G 8: 124,948,495 V187A possibly damaging Het
Fam193a T C 5: 34,439,378 I455T possibly damaging Het
Fdft1 A T 14: 63,163,420 I88N probably damaging Het
Fem1c G A 18: 46,505,160 R592C probably benign Het
Frs2 T A 10: 117,074,582 S292C probably damaging Het
Gm15448 T C 7: 3,821,782 T533A possibly damaging Het
Gpr107 T A 2: 31,171,994 F145I probably benign Het
Gpr153 T A 4: 152,279,373 C83* probably null Het
H2-Q7 T G 17: 35,440,186 probably null Het
Hsp90b1 A T 10: 86,695,748 probably benign Het
Kcnk1 C A 8: 126,025,289 N211K probably damaging Het
Klb T C 5: 65,379,727 V800A probably benign Het
Lat2 T C 5: 134,606,783 Y59C probably damaging Het
Mlkl A T 8: 111,327,801 probably benign Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtbp T A 15: 55,562,942 C93* probably null Het
Myo7a A G 7: 98,081,180 probably benign Het
Myt1 G A 2: 181,807,387 probably benign Het
Ogfrl1 T C 1: 23,375,754 Q224R possibly damaging Het
Olfr418 A G 1: 173,271,002 T276A probably benign Het
Olfr661 A T 7: 104,688,819 H268L probably damaging Het
Osbpl2 A G 2: 180,150,290 probably benign Het
Plb1 C T 5: 32,284,920 T252M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn T C 6: 92,189,693 T657A probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rps6kb2 C A 19: 4,157,883 S348I probably benign Het
Rsrp1 C T 4: 134,924,257 R111W unknown Het
Ryr3 T C 2: 112,732,982 T2933A probably benign Het
Scara5 A G 14: 65,731,019 D247G possibly damaging Het
Slc7a11 C T 3: 50,424,096 S231N probably benign Het
Sod2 A T 17: 13,010,564 N91Y probably damaging Het
Spesp1 A T 9: 62,272,685 S314T probably benign Het
St3gal1 C A 15: 67,113,687 M39I probably benign Het
Stat6 A T 10: 127,658,241 I646F probably damaging Het
Tdrd1 A T 19: 56,865,978 K1119* probably null Het
Thbs2 A G 17: 14,679,815 I600T probably benign Het
Tor1a A G 2: 30,963,838 V160A probably damaging Het
Trdmt1 T G 2: 13,523,438 D104A probably benign Het
Trim58 T C 11: 58,651,393 V393A probably benign Het
Trip4 C T 9: 65,884,918 probably benign Het
Trip6 T C 5: 137,310,821 E341G probably benign Het
Ttn T A 2: 76,715,195 I32595F probably damaging Het
Ubr4 T A 4: 139,428,028 probably null Het
Ush2a G A 1: 188,864,693 V3877I probably benign Het
Vmn1r29 G T 6: 58,307,732 G146C probably damaging Het
Vmn2r53 A G 7: 12,581,780 V704A probably benign Het
Vmn2r7 C T 3: 64,716,367 M268I probably benign Het
Wnt7b G A 15: 85,537,495 T248M probably damaging Het
Zfp663 A G 2: 165,359,075 V13A probably damaging Het
Other mutations in Xab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Xab2 APN 8 3611723 missense probably damaging 1.00
IGL01308:Xab2 APN 8 3616332 missense probably benign 0.07
IGL01324:Xab2 APN 8 3621232 missense possibly damaging 0.80
IGL01340:Xab2 APN 8 3614381 missense probably damaging 1.00
IGL01613:Xab2 APN 8 3610880 missense probably benign 0.01
IGL02622:Xab2 APN 8 3611699 missense probably benign 0.01
IGL02809:Xab2 APN 8 3610175 missense probably benign 0.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0544:Xab2 UTSW 8 3610994 missense probably damaging 1.00
R0607:Xab2 UTSW 8 3613605 missense probably benign 0.05
R0943:Xab2 UTSW 8 3613667 missense probably benign 0.00
R1507:Xab2 UTSW 8 3616031 missense possibly damaging 0.93
R1664:Xab2 UTSW 8 3619068 unclassified probably null
R1954:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R1955:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R3767:Xab2 UTSW 8 3619053 missense probably damaging 1.00
R4399:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4421:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4440:Xab2 UTSW 8 3616353 missense probably benign 0.01
R4553:Xab2 UTSW 8 3611015 missense probably benign 0.00
R4580:Xab2 UTSW 8 3610162 missense probably damaging 1.00
R4608:Xab2 UTSW 8 3618105 missense probably benign 0.23
R4707:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R5522:Xab2 UTSW 8 3611718 missense probably benign 0.06
R6063:Xab2 UTSW 8 3613051 missense possibly damaging 0.93
R6273:Xab2 UTSW 8 3611822 missense probably damaging 1.00
R6487:Xab2 UTSW 8 3613879 missense possibly damaging 0.75
R7140:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGTCATCCACCTGCTTGAAGTTCAC -3'
(R):5'- ATAGTGTCCTTCTGCGCCAGAACC -3'

Sequencing Primer
(F):5'- CTGCTTGAAGTTCACCTTGG -3'
(R):5'- AAGCGTGTAGCCCTCCATC -3'
Posted On2013-09-03