Incidental Mutation 'R0780:Ica1l'
ID76570
Institutional Source Beutler Lab
Gene Symbol Ica1l
Ensembl Gene ENSMUSG00000026018
Gene Nameislet cell autoantigen 1-like
Synonyms1700030B17Rik, Als2cr15
MMRRC Submission 038960-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R0780 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59982490-60043184 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 59997449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027172] [ENSMUST00000189776] [ENSMUST00000191251]
Predicted Effect probably null
Transcript: ENSMUST00000027172
SMART Domains Protein: ENSMUSP00000027172
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189776
SMART Domains Protein: ENSMUSP00000141103
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 7.8e-117 SMART
ICA69 254 439 2.7e-64 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191251
SMART Domains Protein: ENSMUSP00000140520
Gene: ENSMUSG00000026018

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced male fertility with oligospermia, globospermia, and abnormal spermiogenesis, sperm nucleus and mitochondrial sheath morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache C T 5: 137,290,532 R167C probably damaging Het
Ahsa1 T C 12: 87,268,328 I85T probably benign Het
Btaf1 T C 19: 36,988,922 L1030S probably damaging Het
Ccdc163 A G 4: 116,712,407 K222E probably benign Het
Cpsf1 A G 15: 76,600,377 F635L probably benign Het
Cubn G A 2: 13,456,613 T701M probably damaging Het
Cxcr2 T A 1: 74,159,175 M276K probably damaging Het
Daam1 T A 12: 71,947,050 I409K unknown Het
Dnah10 G T 5: 124,750,812 G741W possibly damaging Het
Ifi208 A G 1: 173,682,696 D139G probably benign Het
Kat2b T A 17: 53,567,448 V40E unknown Het
Kmt2d G T 15: 98,862,857 P871T unknown Het
Lats2 A T 14: 57,691,296 Y1041N probably damaging Het
Lifr C T 15: 7,177,466 T486I probably benign Het
Mtmr4 T A 11: 87,611,440 D773E probably benign Het
Ptgds A G 2: 25,468,092 F143S possibly damaging Het
Rp1l1 A G 14: 64,030,351 S1129G possibly damaging Het
Sdk2 A G 11: 113,893,508 V135A probably benign Het
Slc12a8 G A 16: 33,646,665 probably null Het
Thsd7a A G 6: 12,337,274 V1248A probably damaging Het
Tpr T A 1: 150,431,341 H1562Q probably benign Het
Uba3 G A 6: 97,186,705 R294* probably null Het
Vmn2r22 A T 6: 123,637,974 V219E probably damaging Het
Zfand6 T A 7: 84,615,834 I220F probably damaging Het
Other mutations in Ica1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Ica1l APN 1 60013947 missense probably damaging 1.00
IGL01526:Ica1l APN 1 60015757 missense probably damaging 0.99
IGL02538:Ica1l APN 1 60010186 missense probably benign 0.01
IGL02966:Ica1l APN 1 60010139 missense probably damaging 1.00
IGL03379:Ica1l APN 1 59997621 missense probably benign 0.07
PIT4466001:Ica1l UTSW 1 60015836 critical splice acceptor site probably null
R0278:Ica1l UTSW 1 60013996 missense probably benign 0.05
R0926:Ica1l UTSW 1 60006297 missense probably benign 0.09
R1834:Ica1l UTSW 1 60028236 utr 5 prime probably benign
R2402:Ica1l UTSW 1 60006292 missense probably benign 0.00
R4155:Ica1l UTSW 1 60013893 missense possibly damaging 0.71
R4545:Ica1l UTSW 1 60013818 critical splice donor site probably null
R4754:Ica1l UTSW 1 60028162 missense probably damaging 1.00
R4791:Ica1l UTSW 1 60010201 missense probably damaging 1.00
R5096:Ica1l UTSW 1 60028154 missense possibly damaging 0.92
R5217:Ica1l UTSW 1 60015758 missense probably benign 0.03
R5461:Ica1l UTSW 1 60013851 missense probably damaging 1.00
R5780:Ica1l UTSW 1 60028215 missense probably benign 0.04
R6557:Ica1l UTSW 1 59997625 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGGTGAGGTATTGAGGAGACACCC -3'
(R):5'- CATTTCTGAACAGCCTCCTAAGCCC -3'

Sequencing Primer
(F):5'- AGGAGACACCCCTTGTTTCAG -3'
(R):5'- CCACTTCTTCAAGTGCTAGTGAG -3'
Posted On2013-10-16