Incidental Mutation 'R5780:Ica1l'
ID446908
Institutional Source Beutler Lab
Gene Symbol Ica1l
Ensembl Gene ENSMUSG00000026018
Gene Nameislet cell autoantigen 1-like
Synonyms1700030B17Rik, Als2cr15
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59982490-60043184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 60028215 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 5 (E5D)
Ref Sequence ENSEMBL: ENSMUSP00000140520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027172] [ENSMUST00000189776] [ENSMUST00000191251]
Predicted Effect probably benign
Transcript: ENSMUST00000027172
AA Change: E5D

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027172
Gene: ENSMUSG00000026018
AA Change: E5D

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186970
Predicted Effect probably benign
Transcript: ENSMUST00000189776
AA Change: E5D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141103
Gene: ENSMUSG00000026018
AA Change: E5D

DomainStartEndE-ValueType
Arfaptin 15 242 7.8e-117 SMART
ICA69 254 439 2.7e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191251
AA Change: E5D

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140520
Gene: ENSMUSG00000026018
AA Change: E5D

DomainStartEndE-ValueType
Arfaptin 15 242 1.03e-112 SMART
ICA69 254 431 1.35e-75 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit reduced male fertility with oligospermia, globospermia, and abnormal spermiogenesis, sperm nucleus and mitochondrial sheath morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Ica1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Ica1l APN 1 60013947 missense probably damaging 1.00
IGL01526:Ica1l APN 1 60015757 missense probably damaging 0.99
IGL02538:Ica1l APN 1 60010186 missense probably benign 0.01
IGL02966:Ica1l APN 1 60010139 missense probably damaging 1.00
IGL03379:Ica1l APN 1 59997621 missense probably benign 0.07
PIT4466001:Ica1l UTSW 1 60015836 critical splice acceptor site probably null
R0278:Ica1l UTSW 1 60013996 missense probably benign 0.05
R0780:Ica1l UTSW 1 59997449 critical splice donor site probably null
R0926:Ica1l UTSW 1 60006297 missense probably benign 0.09
R1834:Ica1l UTSW 1 60028236 utr 5 prime probably benign
R2402:Ica1l UTSW 1 60006292 missense probably benign 0.00
R4155:Ica1l UTSW 1 60013893 missense possibly damaging 0.71
R4545:Ica1l UTSW 1 60013818 critical splice donor site probably null
R4754:Ica1l UTSW 1 60028162 missense probably damaging 1.00
R4791:Ica1l UTSW 1 60010201 missense probably damaging 1.00
R5096:Ica1l UTSW 1 60028154 missense possibly damaging 0.92
R5217:Ica1l UTSW 1 60015758 missense probably benign 0.03
R5461:Ica1l UTSW 1 60013851 missense probably damaging 1.00
R6557:Ica1l UTSW 1 59997625 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCAGCACACAGAGCCTTC -3'
(R):5'- ATAGGTACAGAACAGCTTTGTAAAG -3'

Sequencing Primer
(F):5'- TCACACTTACCTCCAACTTAGCG -3'
(R):5'- TCTTCATTTTCCAGTATACTGCAAAG -3'
Posted On2016-12-15