Incidental Mutation 'R0812:Cnn3'
ID78459
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission 038992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0812 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121454951 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 72 (G72D)
Ref Sequence ENSEMBL: ENSMUSP00000143186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect probably damaging
Transcript: ENSMUST00000029773
AA Change: G169D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: G169D

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196671
Predicted Effect probably damaging
Transcript: ENSMUST00000197135
AA Change: G123D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: G123D

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198335
Predicted Effect probably damaging
Transcript: ENSMUST00000198393
AA Change: G72D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931
AA Change: G72D

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199188
Predicted Effect probably benign
Transcript: ENSMUST00000199499
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Abcc3 G A 11: 94,375,202 probably benign Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1c A G 6: 118,630,263 C1227R probably benign Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Foxf2 T A 13: 31,627,205 Y376N probably damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
H2-Ob A G 17: 34,244,126 probably benign Het
Hcn4 A G 9: 58,823,512 M1V probably null Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Ndrg2 A G 14: 51,908,662 probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Slfn10-ps G A 11: 83,035,562 noncoding transcript Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r18 C A 5: 151,572,930 probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp507 G A 7: 35,802,623 probably benign Het
Zfp97 T A 17: 17,145,290 F350L possibly damaging Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1368:Cnn3 UTSW 3 121457137 missense probably benign 0.01
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
R7196:Cnn3 UTSW 3 121454788 intron probably null
Predicted Primers PCR Primer
(F):5'- ACCTAGTTGCCTGAGCAAATGCC -3'
(R):5'- GCACTAACTTAGCATACCCTTCCGC -3'

Sequencing Primer
(F):5'- TGAGCAAATGCCTTAGCTCAG -3'
(R):5'- GCGCCCTTTGCTTCAAG -3'
Posted On2013-10-16