Incidental Mutation 'R0811:Tbl1xr1'
ID78510
Institutional Source Beutler Lab
Gene Symbol Tbl1xr1
Ensembl Gene ENSMUSG00000027630
Gene Nametransducin (beta)-like 1X-linked receptor 1
Synonyms8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1
MMRRC Submission 038991-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R0811 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location22076652-22216594 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 22200587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000201509] [ENSMUST00000202747]
Predicted Effect probably benign
Transcript: ENSMUST00000063988
SMART Domains Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192328
SMART Domains Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193734
SMART Domains Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201467
Predicted Effect probably benign
Transcript: ENSMUST00000201509
SMART Domains Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 3.2e-10 SMART
WD40 208 253 6.2e-7 SMART
WD40 255 294 2.9e-9 SMART
WD40 297 335 4.5e-5 SMART
WD40 338 377 5.9e-15 SMART
WD40 380 428 1.1e-11 SMART
WD40 431 470 2.1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202747
SMART Domains Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Tbl1xr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tbl1xr1 APN 3 22192268 critical splice donor site probably null
IGL00825:Tbl1xr1 APN 3 22189786 splice site probably null
IGL01622:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01623:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01717:Tbl1xr1 APN 3 22193171 splice site probably benign
IGL02421:Tbl1xr1 APN 3 22203163 missense probably damaging 0.99
IGL03117:Tbl1xr1 APN 3 22203159 nonsense probably null
R0076:Tbl1xr1 UTSW 3 22189785 missense probably benign 0.06
R0601:Tbl1xr1 UTSW 3 22179319 splice site probably benign
R0629:Tbl1xr1 UTSW 3 22210401 missense probably benign 0.41
R0654:Tbl1xr1 UTSW 3 22203994 critical splice donor site probably null
R1457:Tbl1xr1 UTSW 3 22193169 critical splice donor site probably null
R1496:Tbl1xr1 UTSW 3 22190951 missense possibly damaging 0.68
R1914:Tbl1xr1 UTSW 3 22190910 splice site probably benign
R2680:Tbl1xr1 UTSW 3 22191451 missense possibly damaging 0.76
R3929:Tbl1xr1 UTSW 3 22189768 missense probably damaging 1.00
R4193:Tbl1xr1 UTSW 3 22200358 missense possibly damaging 0.90
R4440:Tbl1xr1 UTSW 3 22200588 critical splice acceptor site probably null
R4642:Tbl1xr1 UTSW 3 22188420 missense probably damaging 1.00
R5187:Tbl1xr1 UTSW 3 22209606 missense probably damaging 1.00
R5361:Tbl1xr1 UTSW 3 22192069 missense probably damaging 0.97
R5430:Tbl1xr1 UTSW 3 22192082 missense probably benign 0.01
R5710:Tbl1xr1 UTSW 3 22210414 missense probably damaging 0.99
R6490:Tbl1xr1 UTSW 3 22203977 missense probably damaging 0.97
R6512:Tbl1xr1 UTSW 3 22140534 intron probably benign
R6778:Tbl1xr1 UTSW 3 22189782 missense probably benign 0.00
R6861:Tbl1xr1 UTSW 3 22191439 missense possibly damaging 0.68
R6861:Tbl1xr1 UTSW 3 22191539 splice site probably null
R6878:Tbl1xr1 UTSW 3 22203204 missense possibly damaging 0.90
R6998:Tbl1xr1 UTSW 3 22179290 missense probably damaging 1.00
X0011:Tbl1xr1 UTSW 3 22203092 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACACACGGTAAGAAGTCTTTCCCC -3'
(R):5'- GATTAACCTATGCCTCGACTGCCTC -3'

Sequencing Primer
(F):5'- AGAAGTCTTTCCCCTTCTGTAAATGG -3'
(R):5'- TGTCATCTGAACAGGAGGCT -3'
Posted On2013-10-16