Incidental Mutation 'R0976:1700056E22Rik'
List |< first << previous [record 79 of 33389] next >> last >|
ID81128
Institutional Source Beutler Lab
Gene Symbol 1700056E22Rik
Ensembl Gene ENSMUSG00000044854
Gene NameRIKEN cDNA 1700056E22 gene
Synonyms
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0976 (G1)
Quality Score98
Status Not validated
Chromosome1
Chromosomal Location184033030-184034301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 184033505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 119 (S119N)
Ref Sequence ENSEMBL: ENSMUSP00000055787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655] [ENSMUST00000050306] [ENSMUST00000139839]
Predicted Effect probably benign
Transcript: ENSMUST00000048655
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050306
AA Change: S119N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055787
Gene: ENSMUSG00000044854
AA Change: S119N

DomainStartEndE-ValueType
SCOP:d1howa_ 12 46 7e-3 SMART
low complexity region 81 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139839
SMART Domains Protein: ENSMUSP00000121433
Gene: ENSMUSG00000039384

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193919
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in 1700056E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:1700056E22Rik UTSW 1 184033907 intron probably benign
R0830:1700056E22Rik UTSW 1 184033427 missense probably damaging 0.99
R0973:1700056E22Rik UTSW 1 184033505 missense probably benign
R1013:1700056E22Rik UTSW 1 184033505 missense probably benign
R1103:1700056E22Rik UTSW 1 184033505 missense probably benign
R1104:1700056E22Rik UTSW 1 184033505 missense probably benign
R1241:1700056E22Rik UTSW 1 184033505 missense probably benign
R1804:1700056E22Rik UTSW 1 184033203 missense probably benign 0.02
R1920:1700056E22Rik UTSW 1 184033631 missense probably benign 0.19
R4705:1700056E22Rik UTSW 1 184033172 missense possibly damaging 0.90
R5135:1700056E22Rik UTSW 1 184033506 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACATACCCCGACCAGTAGTGAC -3'
(R):5'- AGTGTCCATCCAACTTTCCCCAGG -3'

Sequencing Primer
(F):5'- AGTAGTGACCCCTCTGATGGAC -3'
(R):5'- CAACCTGTTCTCAGGAGCC -3'
Posted On2013-11-07