Incidental Mutation 'R0938:P4ha2'
ID81255
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
SynonymsP4hl
MMRRC Submission 039077-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R0938 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54100095-54131665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54119322 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 302 (K302E)
Ref Sequence ENSEMBL: ENSMUSP00000019050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000141258] [ENSMUST00000174616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019050
AA Change: K302E

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906
AA Change: K302E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093107
AA Change: K302E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: K302E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect possibly damaging
Transcript: ENSMUST00000174616
AA Change: K302E

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: K302E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI413582 T C 17: 27,564,394 K43R possibly damaging Het
Bcan A G 3: 87,993,154 S591P possibly damaging Het
Chfr T C 5: 110,164,058 L579P probably damaging Het
Dab2 C T 15: 6,435,384 T439I probably benign Het
Dazap1 T C 10: 80,280,961 S165P possibly damaging Het
Dlx2 C A 2: 71,544,668 W284L possibly damaging Het
Dync2h1 A T 9: 7,002,658 N3803K probably benign Het
Dynlrb2 A C 8: 116,514,968 probably null Het
Fhl2 A G 1: 43,141,706 I108T possibly damaging Het
Fntb A G 12: 76,916,440 Y399C probably damaging Het
Galnt18 T C 7: 111,519,999 I438M possibly damaging Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Ifi204 A T 1: 173,751,745 N511K possibly damaging Het
Klhl1 A T 14: 96,152,040 Y559* probably null Het
Mob1b T A 5: 88,749,593 I120N probably damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Oosp2 G A 19: 11,651,540 Q66* probably null Het
Pard6g C T 18: 80,080,044 R98* probably null Het
Pkdrej G A 15: 85,818,163 P1191S probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ubap2 A C 4: 41,202,304 L708R probably damaging Het
Zfp638 G A 6: 83,984,041 V1204I probably benign Het
Zfp865 G T 7: 5,031,404 C796F possibly damaging Het
Zmiz2 A T 11: 6,397,185 M237L probably benign Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54119305 missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54120158 missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54114170 missense probably benign 0.07
IGL02053:P4ha2 APN 11 54117587 missense probably benign
FR4342:P4ha2 UTSW 11 54110251 small deletion probably benign
R0471:P4ha2 UTSW 11 54117608 missense possibly damaging 0.82
R1467:P4ha2 UTSW 11 54106410 intron probably benign
R1517:P4ha2 UTSW 11 54117645 missense probably benign
R1556:P4ha2 UTSW 11 54125010 missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54119253 missense probably benign 0.28
R3916:P4ha2 UTSW 11 54126248 missense probably benign 0.07
R4853:P4ha2 UTSW 11 54120170 missense probably benign 0.01
R4932:P4ha2 UTSW 11 54125020 missense probably benign 0.05
R5020:P4ha2 UTSW 11 54131190 missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54120188 missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54126412 critical splice donor site probably null
R6632:P4ha2 UTSW 11 54117648 missense probably benign 0.07
R7023:P4ha2 UTSW 11 54131246 missense probably benign 0.01
R7068:P4ha2 UTSW 11 54110994 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGCAGCTCGCAGACCAGTTTC -3'
(R):5'- AGACAATCTCCTGCCCTGTGCATC -3'

Sequencing Primer
(F):5'- AAGCCACGAACGAGCTG -3'
(R):5'- TGTGCATCAGGGAATGCC -3'
Posted On2013-11-07