Incidental Mutation 'R0925:Cdh11'
ID83151
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission 039072-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0925 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102634724 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 661 (I661L)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075190
AA Change: I661L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: I661L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210578
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T A 2: 173,526,074 S47T probably benign Het
Adam5 T C 8: 24,812,425 Q101R probably benign Het
C2cd4c T C 10: 79,612,750 N188D probably benign Het
Cdc27 A G 11: 104,526,049 probably null Het
Csmd1 A G 8: 16,710,618 I167T probably benign Het
Dennd3 T G 15: 73,533,435 F346V probably damaging Het
Dis3l A T 9: 64,341,130 M1K probably null Het
Dnajb6 A T 5: 29,752,400 K60I probably damaging Het
Dock10 T A 1: 80,536,940 H1421L probably benign Het
Elmod3 A T 6: 72,568,938 C274S probably damaging Het
Eme1 T C 11: 94,650,732 E88G probably damaging Het
Fam227a A T 15: 79,620,805 M475K probably benign Het
Frem2 T C 3: 53,653,973 I1038V probably benign Het
Gabpb1 T A 2: 126,652,265 N147Y probably damaging Het
Gm5346 T C 8: 43,626,303 I295V probably benign Het
Gmnc A G 16: 26,960,423 L278P probably benign Het
Gpr153 A G 4: 152,281,874 T299A probably benign Het
H2-M11 T C 17: 36,547,461 V49A probably benign Het
Hemgn T A 4: 46,397,049 K62N probably damaging Het
Hormad2 G A 11: 4,427,297 T47M probably damaging Het
Iqcf6 A G 9: 106,627,301 T55A probably benign Het
Itgam T C 7: 128,112,238 F705L probably benign Het
Klk1 T A 7: 44,228,816 probably null Het
Myo1f A T 17: 33,578,133 I123F probably damaging Het
Nupl1 T C 14: 60,220,141 T538A probably damaging Het
Olfr510 C T 7: 108,668,193 T259I probably benign Het
Olfr592 T A 7: 103,186,823 L74* probably null Het
Pdzd2 C T 15: 12,399,270 R790H probably damaging Het
Pigv T C 4: 133,662,649 K74R probably benign Het
Prmt8 T C 6: 127,697,813 K284R probably benign Het
Rsl1d1 A T 16: 11,199,689 Y138N probably damaging Het
Scara5 AC ACC 14: 65,762,718 probably benign Het
Smc4 T A 3: 69,006,215 probably benign Het
Spta1 G A 1: 174,174,426 V41I possibly damaging Het
Tdrd7 C A 4: 46,025,758 N859K probably damaging Het
Vps13d T G 4: 145,156,551 D824A probably damaging Het
Wdfy2 A T 14: 62,930,226 probably null Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGTCCACATCCACACTGTTG -3'
(R):5'- CTTGCTGATTCTTCAGAGGACTGCC -3'

Sequencing Primer
(F):5'- ACATCCACACTGTTGGGTGC -3'
(R):5'- TGCTGAAGATAGTTCCGACC -3'
Posted On2013-11-08