Incidental Mutation 'R6170:Cdh11'
ID490387
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102634810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 632 (V632A)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000075190
AA Change: V632A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: V632A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210578
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGATGCCGTCAGGATTCTG -3'
(R):5'- ACTGCCAAGTAGCATTGGG -3'

Sequencing Primer
(F):5'- CGTCAGGATTCTGCAGGG -3'
(R):5'- TGCTGAAGATAGTTCCGACC -3'
Posted On2017-10-10