Mutagenetix > Incidental Mutation

Incidental Mutation 'R0891:Septin5'

83515

Institutional Source

Beutler Lab

Gene Symbol

Septin5

Ensembl Gene

ENSMUSG00000072214

Gene Name

septin 5

Synonyms

Cdcrel1, Pnutl1, Sept5

MMRRC Submission

039054-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.409) question?

Stock #

R0891 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18440561-18448688 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 18443595 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Arginine at position 118 (T118R)

Ref Sequence

ENSEMBL: ENSMUSP00000156265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000232653] [ENSMUST00000231956]

AlphaFold

Q9Z2Q6

Predicted Effect

probably benign
Transcript: ENSMUST00000051160

SMART Domains

Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761

Domain	Start	End	E-Value	Type
low complexity region	7	32	N/A	INTRINSIC
LRRNT	33	67	4.14e-11	SMART
low complexity region	75	94	N/A	INTRINSIC
LRRCT	97	150	4.88e-14	SMART
transmembrane domain	159	181	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000096987
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214
AA Change: T109R

Domain	Start	End	E-Value	Type
Pfam:Septin	41	321	1.2e-127	PFAM
Pfam:MMR_HSR1	46	190	5.1e-7	PFAM
low complexity region	355	369	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167388

SMART Domains

Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761

Domain	Start	End	E-Value	Type
LRRNT	25	59	4.14e-11	SMART
low complexity region	67	86	N/A	INTRINSIC
LRRCT	89	142	4.88e-14	SMART
transmembrane domain	151	173	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000231244
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231246

Predicted Effect

probably damaging
Transcript: ENSMUST00000231335
AA Change: T118R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231400

Predicted Effect

probably damaging
Transcript: ENSMUST00000231622
AA Change: T62R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232653
AA Change: T118R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000231956
AA Change: T109R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231642

Meta Mutation Damage Score

0.9539

Coding Region Coverage

1x: 99.7%
3x: 98.9%
10x: 96.7%
20x: 92.2%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene show no gross phenotypic changes. Partial defects in synaptic transmission is reported for one allele, and platelet secretion and modest behavioral defects reported for a different allele. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,884,156 (GRCm39)	N567K	possibly damaging	Het
Afap1	G	A	5: 36,119,196 (GRCm39)		probably null	Het
Angel2	G	T	1: 190,677,270 (GRCm39)	K517N	possibly damaging	Het
Ankrd36	A	G	11: 5,637,316 (GRCm39)	E1295G	possibly damaging	Het
Ankrd45	A	G	1: 160,982,906 (GRCm39)	N139S	possibly damaging	Het
Ano3	T	C	2: 110,528,321 (GRCm39)	T498A	probably benign	Het
Arhgap12	T	C	18: 6,026,699 (GRCm39)	T720A	probably damaging	Het
Brd10	G	A	19: 29,695,053 (GRCm39)	T1547I	probably damaging	Het
Brsk1	A	G	7: 4,707,226 (GRCm39)	S260G	possibly damaging	Het
Calml3	A	G	13: 3,853,926 (GRCm39)	F93S	probably damaging	Het
Ccnf	G	T	17: 24,445,751 (GRCm39)	H498Q	possibly damaging	Het
Col27a1	A	C	4: 63,223,420 (GRCm39)		probably null	Het
Cpne5	A	G	17: 29,421,893 (GRCm39)		probably benign	Het
Dcst1	G	A	3: 89,260,584 (GRCm39)	T560I	probably benign	Het
Fndc7	A	G	3: 108,777,904 (GRCm39)	Y351H	possibly damaging	Het
Gen1	A	G	12: 11,298,355 (GRCm39)		probably benign	Het
Kcnh8	A	T	17: 53,212,242 (GRCm39)	D680V	probably damaging	Het
Kmt2d	A	G	15: 98,750,572 (GRCm39)		probably benign	Het
Lrrfip1	T	A	1: 90,996,337 (GRCm39)	I50N	probably damaging	Het
Mbip	A	T	12: 56,387,242 (GRCm39)	D132E	possibly damaging	Het
Nipal3	A	T	4: 135,195,898 (GRCm39)	I235N	possibly damaging	Het
Nup93	T	A	8: 95,007,891 (GRCm39)		probably benign	Het
Or6b13	A	G	7: 139,782,372 (GRCm39)	Y104H	probably damaging	Het
Or6z6	T	A	7: 6,491,471 (GRCm39)	Y134F	probably damaging	Het
Pgbd1	T	C	13: 21,606,970 (GRCm39)	Y408C	probably damaging	Het
Pigo	G	A	4: 43,020,519 (GRCm39)	Q808*	probably null	Het
Pik3r1	A	T	13: 101,837,974 (GRCm39)	N299K	probably benign	Het
Pip5k1a	A	G	3: 94,972,831 (GRCm39)		probably benign	Het
Semp2l1	T	A	1: 32,585,442 (GRCm39)	H156L	possibly damaging	Het
Smarcal1	T	C	1: 72,638,015 (GRCm39)	V483A	probably damaging	Het
Togaram1	A	G	12: 65,029,421 (GRCm39)	D948G	probably benign	Het
Vmn2r75	A	T	7: 85,813,476 (GRCm39)	V442E	possibly damaging	Het
Zfp57	A	G	17: 37,317,068 (GRCm39)	K46E	probably damaging	Het

Other mutations in Septin5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01411:Septin5	APN	16	18,443,680 (GRCm39)	missense	probably damaging	1.00
IGL02124:Septin5	APN	16	18,443,579 (GRCm39)	missense	probably damaging	0.98
IGL02211:Septin5	APN	16	18,443,629 (GRCm39)	missense	probably damaging	1.00
IGL02934:Septin5	APN	16	18,448,581 (GRCm39)	missense	probably damaging	0.99
R0518:Septin5	UTSW	16	18,443,647 (GRCm39)	missense	probably benign	0.02
R0521:Septin5	UTSW	16	18,443,647 (GRCm39)	missense	probably benign	0.02
R0627:Septin5	UTSW	16	18,444,115 (GRCm39)	missense	possibly damaging	0.90
R0746:Septin5	UTSW	16	18,441,975 (GRCm39)	missense	probably damaging	1.00
R1037:Septin5	UTSW	16	18,441,844 (GRCm39)	splice site	probably benign
R1850:Septin5	UTSW	16	18,443,960 (GRCm39)	missense	probably damaging	1.00
R2044:Septin5	UTSW	16	18,441,762 (GRCm39)	missense	probably benign	0.10
R3872:Septin5	UTSW	16	18,441,723 (GRCm39)	missense	probably damaging	0.98
R4498:Septin5	UTSW	16	18,442,142 (GRCm39)	missense	probably damaging	1.00
R5503:Septin5	UTSW	16	18,442,118 (GRCm39)	missense	probably benign	0.00
R5963:Septin5	UTSW	16	18,442,962 (GRCm39)	splice site	probably null
R6286:Septin5	UTSW	16	18,442,127 (GRCm39)	missense	probably damaging	0.99
R7014:Septin5	UTSW	16	18,443,659 (GRCm39)	missense	probably damaging	1.00
R7909:Septin5	UTSW	16	18,443,372 (GRCm39)	missense	probably damaging	1.00
R8708:Septin5	UTSW	16	18,443,622 (GRCm39)	missense	probably benign	0.01
R8888:Septin5	UTSW	16	18,441,861 (GRCm39)	missense	possibly damaging	0.81
R8895:Septin5	UTSW	16	18,441,861 (GRCm39)	missense	possibly damaging	0.81
R9210:Septin5	UTSW	16	18,442,961 (GRCm39)	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCCACTCTCATCACGGAAATACTGC -3'
(R):5'- TGGCCCGGAGTATACATTCAGACAG -3'

Sequencing Primer
(F):5'- GAAATACTGCTCAAACTGCTGGTC -3'
(R):5'- TTCAGACAGAGACTGAAGCC -3'

Posted On

2013-11-08