Mutagenetix > Incidental Mutation

Incidental Mutation 'R1133:Socs4'

94553

Institutional Source

Beutler Lab

Gene Symbol

Socs4

Ensembl Gene

ENSMUSG00000048379

Gene Name

suppressor of cytokine signaling 4

Synonyms

Socs7, 3110032M18Rik, A730004F22Rik

MMRRC Submission

039206-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.425) question?

Stock #

R1133 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47514388-47533559 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47527651 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 195 (I195M)

Ref Sequence

ENSEMBL: ENSMUSP00000066031 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000227413]

AlphaFold

Q91ZA6

Predicted Effect

probably benign
Transcript: ENSMUST00000065562
AA Change: I195M

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379
AA Change: I195M

Domain	Start	End	E-Value	Type
low complexity region	30	47	N/A	INTRINSIC
Pfam:SOCS	55	108	6.8e-23	PFAM
low complexity region	219	232	N/A	INTRINSIC
SH2	281	367	1.11e-16	SMART
SOCS	377	420	1.69e-16	SMART
SOCS_box	383	419	1.13e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227413

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.1%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 8 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahr	A	G	12: 35,576,805 (GRCm39)	L42P	probably damaging	Het
B430305J03Rik	C	T	3: 61,271,430 (GRCm39)	W105*	probably null	Het
Gpr156	T	A	16: 37,825,683 (GRCm39)	N633K	probably benign	Het
Hook2	T	C	8: 85,722,433 (GRCm39)	L324P	probably damaging	Het
Ift70a2	G	A	2: 75,807,727 (GRCm39)	Q262*	probably null	Het
Or8b3	A	T	9: 38,315,027 (GRCm39)	M283L	probably benign	Het
Syne1	A	G	10: 5,299,044 (GRCm39)	I1014T	possibly damaging	Het
Ugt2b38	T	G	5: 87,560,232 (GRCm39)	N361H	probably damaging	Het

Other mutations in Socs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Socs4	APN	14	47,527,709 (GRCm39)	missense	probably benign
IGL01942:Socs4	APN	14	47,528,107 (GRCm39)	nonsense	probably null
IGL02039:Socs4	APN	14	47,527,650 (GRCm39)	missense	probably benign
IGL02117:Socs4	APN	14	47,528,264 (GRCm39)	missense	probably damaging	1.00
R0281:Socs4	UTSW	14	47,527,325 (GRCm39)	missense	probably benign	0.25
R0703:Socs4	UTSW	14	47,527,505 (GRCm39)	missense	probably damaging	1.00
R0763:Socs4	UTSW	14	47,528,112 (GRCm39)	missense	probably damaging	1.00
R0842:Socs4	UTSW	14	47,527,426 (GRCm39)	missense	probably damaging	0.98
R1280:Socs4	UTSW	14	47,528,370 (GRCm39)	missense	probably benign	0.23
R1619:Socs4	UTSW	14	47,527,740 (GRCm39)	missense	possibly damaging	0.87
R1632:Socs4	UTSW	14	47,527,034 (GRCm39)	start gained	probably benign
R5058:Socs4	UTSW	14	47,527,589 (GRCm39)	nonsense	probably null
R6008:Socs4	UTSW	14	47,527,618 (GRCm39)	missense	probably damaging	0.98
R6648:Socs4	UTSW	14	47,527,633 (GRCm39)	missense	probably benign	0.02
R6925:Socs4	UTSW	14	47,527,195 (GRCm39)	nonsense	probably null
R7408:Socs4	UTSW	14	47,527,296 (GRCm39)	missense	probably benign	0.00
R9162:Socs4	UTSW	14	47,528,301 (GRCm39)	missense	probably damaging	0.99
R9234:Socs4	UTSW	14	47,527,716 (GRCm39)	missense	probably benign	0.00
R9428:Socs4	UTSW	14	47,528,034 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGACACACTGTTCCTATGAGTCCC -3'
(R):5'- TTGTCCATGACACCCCAGTAGCAC -3'

Sequencing Primer
(F):5'- CTATGAGTCCCAACTCAGATGAATGG -3'
(R):5'- CACGGATTGTTACTGATCTGAAG -3'

Posted On

2014-01-05