Incidental Mutation 'R1004:Serpinb9f'
ID97987
Institutional Source Beutler Lab
Gene Symbol Serpinb9f
Ensembl Gene ENSMUSG00000038327
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9f
SynonymsNK21, ovalbumin, Spi13
MMRRC Submission 039114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1004 (G1)
Quality Score119
Status Not validated
Chromosome13
Chromosomal Location33324077-33335370 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TA to "TTTNA,T" at 33334242 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075515]
Predicted Effect probably benign
Transcript: ENSMUST00000075515
SMART Domains Protein: ENSMUSP00000074958
Gene: ENSMUSG00000038327

DomainStartEndE-ValueType
SERPIN 13 377 2.03e-166 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,151,954 I423T possibly damaging Het
Agbl3 A T 6: 34,803,451 E453V probably damaging Het
Agxt A G 1: 93,135,699 M108V possibly damaging Het
Akap13 T C 7: 75,687,286 I831T probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arid1a A G 4: 133,687,275 M1215T unknown Het
Cd163 G T 6: 124,325,347 D957Y probably damaging Het
Ces2e A G 8: 104,929,738 D200G probably damaging Het
Cfap54 T C 10: 93,066,696 probably benign Het
Col11a1 A G 3: 114,095,022 probably benign Het
Dlx6 C T 6: 6,863,665 Q96* probably null Het
Dpp4 T A 2: 62,332,640 Q754L probably benign Het
Ece1 A G 4: 137,926,239 T100A probably benign Het
Gabbr2 C T 4: 46,677,544 V779M possibly damaging Het
Gatm C T 2: 122,609,660 probably benign Het
Gm20767 T A 13: 120,155,022 D132E probably benign Het
Gpc2 A G 5: 138,278,225 L213P probably damaging Het
Hook1 A C 4: 96,022,287 N713H probably benign Het
Kdm5b T A 1: 134,588,904 I178K possibly damaging Het
Mettl9 G A 7: 121,076,237 V287I probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mycbp2 G A 14: 103,140,917 T3774I probably benign Het
Nupl1 C A 14: 60,247,481 probably benign Het
Nxf1 A T 19: 8,764,317 T119S probably benign Het
Oaz3 T A 3: 94,435,043 H102L probably damaging Het
Olfr971 T C 9: 39,839,980 F182S probably benign Het
Pfpl A T 19: 12,430,425 Q680L probably benign Het
Poli T A 18: 70,525,438 Q75L probably benign Het
Ppp2r3a C T 9: 101,198,630 probably null Het
Prr30 A G 14: 101,199,093 L11P probably damaging Het
Ptchd4 A T 17: 42,377,602 Y345F probably benign Het
Ric1 A G 19: 29,602,357 N1233S probably benign Het
Sh3bgrl2 C T 9: 83,577,631 probably benign Het
Skp1a G C 11: 52,237,380 probably benign Het
Slc12a9 T C 5: 137,322,524 K528R probably damaging Het
Slc22a6 A G 19: 8,618,399 N35S probably damaging Het
Xrcc5 A G 1: 72,383,778 probably benign Het
Zfp235 T A 7: 24,140,744 L266Q probably damaging Het
Zfp600 T A 4: 146,196,533 probably benign Het
Other mutations in Serpinb9f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Serpinb9f APN 13 33334468 missense probably damaging 1.00
IGL03272:Serpinb9f APN 13 33327916 missense probably damaging 1.00
R0112:Serpinb9f UTSW 13 33327951 splice site probably benign
R0254:Serpinb9f UTSW 13 33334591 missense probably damaging 1.00
R0498:Serpinb9f UTSW 13 33326007 splice site probably benign
R0711:Serpinb9f UTSW 13 33327921 missense probably damaging 1.00
R1913:Serpinb9f UTSW 13 33325846 missense probably damaging 1.00
R2214:Serpinb9f UTSW 13 33334609 missense probably benign 0.00
R3908:Serpinb9f UTSW 13 33327936 missense probably damaging 0.99
R6182:Serpinb9f UTSW 13 33334422 missense probably damaging 1.00
R6421:Serpinb9f UTSW 13 33334533 missense probably benign 0.01
R6965:Serpinb9f UTSW 13 33325876 missense possibly damaging 0.50
R7043:Serpinb9f UTSW 13 33325987 missense possibly damaging 0.85
X0019:Serpinb9f UTSW 13 33334534 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGCTACCAGGACAGTGGGTTACC -3'
(R):5'- TGTGAACAAACTCGGACAGACACAG -3'

Sequencing Primer
(F):5'- GGACAGTGGGTTACCCATACTTC -3'
(R):5'- TCGGACAGACACAGGTTTTC -3'
Posted On2014-01-05