Mutagenetix > Incidental Mutation

Incidental Mutation 'R1212:Supt16'

99452

Institutional Source

Beutler Lab

Gene Symbol

Supt16

Ensembl Gene

ENSMUSG00000035726

Gene Name

SPT16, facilitates chromatin remodeling subunit

Synonyms

Spt16, Fact140, Supt16h, Cdc68

MMRRC Submission

039281-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R1212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52397876-52434696 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 52411581 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 601 (R601*)

Ref Sequence

ENSEMBL: ENSMUSP00000042283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046709]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000046709
AA Change: R601*

SMART Domains

Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: R601*

Domain	Start	End	E-Value	Type
FACT-Spt16_Nlob	5	168	2.95e-87	SMART
Pfam:Peptidase_M24	181	411	2.9e-35	PFAM
low complexity region	435	449	N/A	INTRINSIC
coiled coil region	462	493	N/A	INTRINSIC
SPT16	529	689	3.38e-96	SMART
Rtt106	806	896	1.61e-38	SMART
low complexity region	926	946	N/A	INTRINSIC
low complexity region	951	988	N/A	INTRINSIC
coiled coil region	994	1023	N/A	INTRINSIC

Coding Region Coverage

1x: 98.7%
3x: 97.4%
10x: 93.2%
20x: 82.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ambra1	G	A	2: 91,599,381 (GRCm39)	R167H	possibly damaging	Het
Ankrd50	G	A	3: 38,509,836 (GRCm39)	R844C	probably damaging	Het
Arfgef1	T	C	1: 10,286,784 (GRCm39)	E42G	probably benign	Het
Arhgap42	T	A	9: 9,015,313 (GRCm39)	I444F	probably damaging	Het
Cspg4b	G	A	13: 113,505,951 (GRCm39)		probably benign	Het
Ift56	A	G	6: 38,387,728 (GRCm39)	D393G	probably damaging	Het
Ift70a2	A	T	2: 75,806,823 (GRCm39)	I563N	probably damaging	Het
Il25	G	A	14: 55,170,212 (GRCm39)		probably benign	Het
Jak1	A	G	4: 101,046,291 (GRCm39)	L105P	probably damaging	Het
Or2ad1	C	T	13: 21,326,337 (GRCm39)	V297I	probably benign	Het
Ralgapa2	A	G	2: 146,199,902 (GRCm39)	V1214A	probably benign	Het
Shtn1	T	C	19: 59,039,322 (GRCm39)	D39G	probably damaging	Het
Vmn1r113	A	T	7: 20,521,356 (GRCm39)	R49S	probably benign	Het
Vmn1r64	C	T	7: 5,887,210 (GRCm39)	S111N	probably damaging	Het

Other mutations in Supt16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Supt16	APN	14	52,399,255 (GRCm39)	missense	possibly damaging	0.72
IGL00985:Supt16	APN	14	52,399,148 (GRCm39)	missense	possibly damaging	0.53
IGL01160:Supt16	APN	14	52,420,589 (GRCm39)	missense	probably benign
IGL01328:Supt16	APN	14	52,414,489 (GRCm39)	missense	probably benign	0.20
IGL01329:Supt16	APN	14	52,414,489 (GRCm39)	missense	probably benign	0.20
IGL01413:Supt16	APN	14	52,414,489 (GRCm39)	missense	probably benign	0.20
IGL01414:Supt16	APN	14	52,414,489 (GRCm39)	missense	probably benign	0.20
IGL01535:Supt16	APN	14	52,414,647 (GRCm39)	missense	probably damaging	0.99
IGL01765:Supt16	APN	14	52,417,680 (GRCm39)	missense	probably damaging	0.98
IGL01976:Supt16	APN	14	52,419,764 (GRCm39)	missense	possibly damaging	0.70
IGL02422:Supt16	APN	14	52,417,000 (GRCm39)	missense	possibly damaging	0.85
IGL02449:Supt16	APN	14	52,411,263 (GRCm39)	missense	possibly damaging	0.92
IGL02516:Supt16	APN	14	52,421,421 (GRCm39)	missense	possibly damaging	0.57
IGL02831:Supt16	APN	14	52,408,335 (GRCm39)	missense	possibly damaging	0.70
IGL03112:Supt16	APN	14	52,413,855 (GRCm39)	missense	probably damaging	0.98
IGL03406:Supt16	APN	14	52,415,598 (GRCm39)	missense	possibly damaging	0.92
R7336_Supt16_529	UTSW	14	52,408,948 (GRCm39)	missense	possibly damaging	0.93
watercolor	UTSW	14	52,408,338 (GRCm39)	missense	probably damaging	0.96
R0332:Supt16	UTSW	14	52,418,614 (GRCm39)	missense	probably damaging	0.99
R0385:Supt16	UTSW	14	52,414,175 (GRCm39)	missense	probably benign	0.01
R0389:Supt16	UTSW	14	52,411,570 (GRCm39)	missense	probably damaging	0.98
R0422:Supt16	UTSW	14	52,421,453 (GRCm39)	missense	probably benign	0.26
R1101:Supt16	UTSW	14	52,408,896 (GRCm39)	missense	probably null	0.81
R1487:Supt16	UTSW	14	52,414,065 (GRCm39)	critical splice donor site	probably null
R1494:Supt16	UTSW	14	52,409,916 (GRCm39)	missense	probably benign	0.01
R1566:Supt16	UTSW	14	52,414,112 (GRCm39)	missense	probably damaging	0.99
R1652:Supt16	UTSW	14	52,414,637 (GRCm39)	missense	probably benign	0.34
R1913:Supt16	UTSW	14	52,415,592 (GRCm39)	missense	possibly damaging	0.84
R2220:Supt16	UTSW	14	52,409,601 (GRCm39)	nonsense	probably null
R2344:Supt16	UTSW	14	52,415,575 (GRCm39)	missense	probably benign	0.00
R3430:Supt16	UTSW	14	52,412,816 (GRCm39)	missense	probably benign	0.05
R3746:Supt16	UTSW	14	52,417,596 (GRCm39)	missense	probably damaging	0.99
R3749:Supt16	UTSW	14	52,417,596 (GRCm39)	missense	probably damaging	0.99
R4010:Supt16	UTSW	14	52,401,898 (GRCm39)	missense	probably damaging	1.00
R4108:Supt16	UTSW	14	52,400,188 (GRCm39)	missense	probably damaging	1.00
R4109:Supt16	UTSW	14	52,400,188 (GRCm39)	missense	probably damaging	1.00
R4597:Supt16	UTSW	14	52,411,046 (GRCm39)	missense	probably damaging	1.00
R5117:Supt16	UTSW	14	52,420,549 (GRCm39)	missense	probably damaging	1.00
R5309:Supt16	UTSW	14	52,400,155 (GRCm39)	missense	probably damaging	1.00
R5695:Supt16	UTSW	14	52,411,601 (GRCm39)	splice site	probably null
R5895:Supt16	UTSW	14	52,401,979 (GRCm39)	missense	probably benign	0.17
R5941:Supt16	UTSW	14	52,419,653 (GRCm39)	missense	probably benign
R5993:Supt16	UTSW	14	52,415,791 (GRCm39)	missense	probably damaging	1.00
R6197:Supt16	UTSW	14	52,408,338 (GRCm39)	missense	probably damaging	0.96
R6254:Supt16	UTSW	14	52,408,291 (GRCm39)	missense	probably damaging	1.00
R6381:Supt16	UTSW	14	52,417,003 (GRCm39)	missense	probably benign	0.02
R6667:Supt16	UTSW	14	52,409,520 (GRCm39)	missense	probably damaging	1.00
R7000:Supt16	UTSW	14	52,408,907 (GRCm39)	missense	probably damaging	0.97
R7063:Supt16	UTSW	14	52,409,505 (GRCm39)	missense	possibly damaging	0.92
R7276:Supt16	UTSW	14	52,414,458 (GRCm39)	missense	probably benign
R7336:Supt16	UTSW	14	52,408,948 (GRCm39)	missense	possibly damaging	0.93
R7344:Supt16	UTSW	14	52,411,028 (GRCm39)	missense	probably damaging	0.98
R7384:Supt16	UTSW	14	52,418,619 (GRCm39)	missense	probably damaging	0.99
R7411:Supt16	UTSW	14	52,415,508 (GRCm39)	missense	probably damaging	1.00
R7586:Supt16	UTSW	14	52,411,013 (GRCm39)	missense	probably damaging	0.97
R7633:Supt16	UTSW	14	52,434,556 (GRCm39)	missense	probably benign	0.38
R8024:Supt16	UTSW	14	52,408,332 (GRCm39)	missense	probably damaging	0.96
R8197:Supt16	UTSW	14	52,411,542 (GRCm39)	missense	possibly damaging	0.95
R8201:Supt16	UTSW	14	52,408,447 (GRCm39)	missense	probably damaging	1.00
R8285:Supt16	UTSW	14	52,418,540 (GRCm39)	missense	possibly damaging	0.95
R8508:Supt16	UTSW	14	52,419,046 (GRCm39)	missense	probably damaging	1.00
R8531:Supt16	UTSW	14	52,410,020 (GRCm39)	missense	probably damaging	0.98
R8797:Supt16	UTSW	14	52,409,960 (GRCm39)	missense	probably damaging	0.99
R8872:Supt16	UTSW	14	52,411,544 (GRCm39)	missense	probably benign	0.01
R9048:Supt16	UTSW	14	52,418,513 (GRCm39)	missense	probably damaging	1.00
R9743:Supt16	UTSW	14	52,408,939 (GRCm39)	missense	probably damaging	1.00
Z1177:Supt16	UTSW	14	52,418,994 (GRCm39)	missense	probably null	0.21
Z1177:Supt16	UTSW	14	52,400,742 (GRCm39)	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- TGTGCATGGAGCCTTCATACCAAC -3'
(R):5'- GTTAAGCCATCTGGGCATGGTagc -3'

Sequencing Primer
(F):5'- CTTCCAAAGACCTGTCTGTACAAAG -3'
(R):5'- ggggaggtagagacaggg -3'

Posted On

2014-01-15