Allele | allia | |||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | |||||||||||||||||||||||||||||||||||
Chromosome | 1 | |||||||||||||||||||||||||||||||||||
Coordinate | 165,682,783 bp (GRCm39) | |||||||||||||||||||||||||||||||||||
Base Change | A ⇒ T (forward strand) | |||||||||||||||||||||||||||||||||||
Gene | Cd247 | |||||||||||||||||||||||||||||||||||
Gene Name | CD247 antigen | |||||||||||||||||||||||||||||||||||
Synonym(s) | Cd3z, Tcrz, T3z, TCRk, CD3-eta, CD3 zeta, CD3zeta, CD3-zeta/eta, Cd3h, CD3-zeta, 4930549J05Rik | |||||||||||||||||||||||||||||||||||
Chromosomal Location | 165,616,250-165,704,846 bp (+) (GRCm39) | |||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is T-cell receptor zeta, which together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and -epsilon, forms the T-cell receptor-CD3 complex. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced numbers of CD4+CD8+ cells, and near absence of CD4+CD8-, CD4-CD8+ cells, and TCR expression in the thymus, but the presence of single positive T cells in lymph nodes. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: CD247 antigen isoform zeta precursor (NM_001113391.2); CD247 antigen isoform iota precursor (NM_001113392.2); CD247 antigen isoform theta precursor (NM_001113393.2); CD247 antigen isoform kappa precursor (NM_001113394.2); CD247 antigen isoform eta precursor (NM_031162.4); MGI:88334 | |||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||
Amino Acid Change | Aspartic acid changed to Valine | |||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||
AlphaFold | P24161 | |||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000005907 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000027849 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000083165 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000124299 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000124297 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000136456 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000140926 Gene: ENSMUSG00000005763 AA Change: D36V
|
|||||||||||||||||||||||||||||||||||
Predicted Effect | probably damaging
PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00) |
|||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||
Is this an essential gene? | Probably nonessential (E-score: 0.079) | |||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||
Penetrance | unknown | |||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | ||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||
Local Stock | Live Mice, Sperm | |||||||||||||||||||||||||||||||||||
MMRRC Submission | 036308-MU | |||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||
Record Created | 2011-03-25 8:09 PM by Owen M. Siggs | |||||||||||||||||||||||||||||||||||
Record Posted | 2011-11-03 | |||||||||||||||||||||||||||||||||||
Phenotypic Description |
The allia phenotype was identified in a screen of G3 mice that were sublethally irradiated and then intravenously injected with wild-type bone marrow cells (CD45.1+). Flow cytometry analysis was used to assess the contribution of bone marrow cells from the G3 mice (CD45.2+) and those from the wild type to the reconstitution of the hematopoietic compartment. The allia CD4+ T cells were outcompeted by wild type cells but the other allia hematopoietic cell types repopulated normally (Figure 1).
|
|||||||||||||||||||||||||||||||||||
Nature of Mutation | The allia mutation was mapped by bulk segregation analysis (BSA) of progeny from intercrosses of (C57BL/10J x C57BL/6J-allia) F1 mice (n=11 with mutant phenotype, 25 with normal phenotype). The mutation was near the marker B10SNPSG0020 at position 173342737 on Chromosome 1 (synthetic LOD = 5.9971). Sequencing of the candidate gene, Cd247, which was within the critical region, identified an A to T transversion at position 255 (in exon 2 of 8 exons) of the mRNA sequence of Cd247 (NM_001113391.2), encoding CD3 zeta (ζ) and CD3 eta (η) . The mutation is 5.56 Mb from the marker with peak linkage. 235 CAAACTCTGCTACTTGCTAGATGGAATCCTCTTCATCTACGG 30 --K--L--C--Y--L--L--D--G--I--L--F--I--Y--G The mutated nucleotide is indicated in red lettering and causes a D to V substitution at residue 36 of the CD3ζ protein. | |||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||
Protein Prediction | The T-cell receptor (TCR) complex is composed of several subunits: (i) a TCR alpha/beta (α/β) or TCR delta/gamma (δ/γ) heterodimer; (ii) two CD3 epsilon (ε) chains (see tumormouse), one dimerized with a CD3γ chain, the other with a CD3δ chain, and (iii) a CD3ζ homodimer or a CD3ζ/η heterodimer (1-6). Cd247 has 5 isoforms: ζ, η, theta (θ), iota (ι) and kappa (κ). The ζ, η, and θ transcripts are protein-coding; the ι and κ transcripts are non-coding. The ζ transcript is the shortest; the θ, κ, η and ι variants are longer than ζ and have distinct C-termini from ζ due to alternate exon structures in the 3’ coding region and 3’ untranslated region (NC_000067.5). The CD3ζ (P24161) and CD3η (P29020) proteins are units of the TCR-CD3 complex that are encoded by alternatively spliced transcripts of Cd247 (7-9). The CD3ζ transcript is 1.315 kb with a coding region of 492 bp and a 906 bp 3’ untranslated region encoded by exon 8 (of 8) (10). Alternative splicing of the CD3ζ transcript at two internal (5′ and 3′) splice sites within the 3′-UTR results in deletion of nucleotides 672–1233 and generation of a 344-bp alternatively spliced variant. The 344-bp CD3ζ isoform lacks two critical regulatory adenosine/uridine-rich elements (ARE) and a translation regulatory sequence (10). As a result, the isoform’s stability and translation are significantly lower than that of the 906-bp CD3ζ isoform leading to a decrease in the amount of protein that is expressed (10). The CD3ζ/η locus can also encode the ubiquitously expressed transcription factor, Oct-1, on its opposite strand (9). Oct-1 is a member of the POU domain transcription factor family and has roles in neural development, cell growth, differentiation, cell stress and metabolic signaling (11). In a study that used targeted disruption of the CD3η gene, reduction in the expression level of Oct-1 transcripts was observed (7).
The proteins encoded by the CD3ζ and CD3η transcripts are structurally homologous to each other, but distinct from the CD3γ, δ, and ε chains (1;12). The CD3γδε chains have an Ig-like extracellular domain, a transmembrane domain and a cytoplasmic tail (13). In contrast, the 164 amino acid, 18 kDa CD3ζ and the 206 amino acid, 24 kDa CD3η chains have an N-terminal signal peptide (aa 1-21), nine extracellular amino acids (aa 22-30), a helical transmembrane domain (aa 31-51) and a cytoplasmic domain (aa 52-164, CD3ζ; aa 52-206, CD3η) (1;3;14) (Figure 2). CD3ζ’s cytoplasmic domain can mask internalization motifs of other CD3 family members, allowing for enhanced expression of the TCR-CD3 complex at the cell surface (4). To control premature activation of the receptor, the CD3ζ tyrosines that are phosphorylated upon receptor activation are buried within the membrane (15). All of the CD3 proteins have immunoreceptor tyrosine-based activation motifs (ITAMs) at their cytoplasmic tail that are essential in transducing the TCR activation signal across the membrane (4;7;9). The ITAM motif is comprised of a tyrosine (Y) residue, two other amino acids (x) and a leucine or isoleucine (L/I) residue (YxxL/I). The sequences are separated from each other by 7-12 amino acids (TxxL/Ix(7-12)TxxL/I). CD3η and CD3ζ chains have three of these motifs (aa 61-89, 100-128, 131-159 in CD3ζ; 61-89, 100-128 in CD3η), the others have one (3). In the complete TCR-CD3 complex, the ITAMs of the CD3 proteins provide ten phosphorylation sites that facilitate the recruitment of ZAP-70 (see murdock, mrtless, trebia and wanna), a tyrosine kinase essential for downstream signaling, to the receptor complex (3). Upon receptor activation, phosphorylation of CD3ζ ITAM domains signals for the continual internalization and recycling of the TCR-CD3 complex and its subsequent degradation within lysosomes (16).
The CD3ε/γ, ε/δ, ζ/ζ and ζ/η dimer formation and their association with the TCR chains are essential for receptor cell surface expression and subsequent T cell activation. CD3γ, δ, and ε have a CxxCxExx motif (C = cysteine, E = glutamic acid and x = any amino acid) in their extracellular domains. Intra-chain disulfide bonds between cysteine residues within these motifs in adjacent chains and hydrogen bonds between the extracellular domains of the CD3ε and either the δ or γ chains facilitate the formation of dimers (4;13). The TCR and CD3 subunits associate with each other through charged (aspartic or glutamic acid) residues within their transmembrane domains (4;15). Most TCR-CD3 complexes contain a disulfide bonded CD3ζ homodimer; 5-10% of the complexes contain a CD3 zeta/eta (ζ/η) heterodimer (7). The TCR complex can also associate with homodimers of the receptor for IgE (FcεRIγ), which shares structural homology to CD3ζ and CD3η and is predominantly expressed on mast cells, basophils and FcRγ+ T cells (e.g. the LGL T cell line) (12;17;18). Studies have shown that in the absence of CD3ζ/η or CD3ζ/ζ dimers, a FcεRIγ homodimer is incorporated into the TCR-CD3 complex, expressed at the cell surface, and activated T cell receptor-mediated signal transduction and subsequent interleukin (IL)-2 production occurs (12;17;19;20). The three dimensional structure of the CD3ζ homodimer has been determined (Figure 3) (5). The allia mutation results in an aspartic acid (D) to valine (V) amino acid change at residue 36 within the transmembrane domains of both CD3ζ and CD3η. The transmembrane structure of the CD3ζ homodimer has been extensively studied and it has been determined that D36 is one of 8 residues within the transmembrane domain that is essential for the dimerization of the CD3ζ chains (5;21;22). The two aspartic acids pack closely within the interface of the transmembrane domain. Although substitution of D36 with a nonpolar head group (e.g. valine, as in allia) has not been studied, substitution with a polar head group (e.g. asparagine or serine) reduced the dimer formation by ~40% (5). Mutations at D36 have been shown to disrupt dimer formation by the prevention of disulfide bond formation (between Cys32 on adjacent chains) (5). In addition, D36 seems to be essential for creating a unique structural scaffold between the CD3ζ side-chains, the cysteines at residue 32, and water molecule(s) that are required for association with the TCR (5;21;22). | |||||||||||||||||||||||||||||||||||
Expression/Localization | The 31 kb Cd247 gene is conserved in human, chimpanzee, cow, rat, and chicken (NC_000067). In the mouse, the Cd247 transcripts appear early in gestation, with the CD3ζ and CD3η transcripts detected as early as gestational days 15 or 16 (9). In the early stages of T cell development, the mRNA levels of CD3ζ and CD3η remain constant (9). However, in mature cells the levels drop 10-fold and then remain constant when the TCR-mediated developmental signal is no longer needed (9). Both transcriptional and post-transcriptional regulatory mechanisms determine the expression levels of CD3ζ and CD3η mRNA (9). The TCR-CD3 complex is formed in the endoplasmic reticulum (ER) and provides a quality checkpoint for the complex in that the residues that are essential to stabilize the complex can also act as degradation signals for the incomplete complexes (15;23). Although incomplete CD3 dimers and TCR-CD3 complexes are retained in the endoplasmic reticulum (ER), it has been proposed that CD3ζ can mask the ER retention motifs of the CD3 chains allowing for incomplete TCR-CD3 complexes to be transported to the cell surface (4). CD3ζ also has a role in facilitating surface expression of the TCR-CD3 complex and maintaining the integrity of complete and partial TCR-CD3 complexes through sequences near its transmembrane domain (1;2;9;24). Studies have also shown that a significant amount of tyrosine-phosphorylated CD3ζ accumulates in perinuclear endosomal vesicles with recycled TCR complexes and can activate TCR-mediated signaling, possibly acting as a substrate of the Src-family kinase, Lck, that is present on Rab11-positive endosomes, a subset of ribosomes that are essential for endocytic recycling (16;25). | |||||||||||||||||||||||||||||||||||
Background | Induction of a cell-mediated adaptive immune response requires T cell receptor recognition and binding of a peptide presented by the major histocompatibility complex (MHC) on an antigen presenting cell (APC) (i.e. dendritic cells, macrophages and B cells) (6). Binding of the peptide-MHC complex activates the T-lymphocyte, facilitating its proliferation and differentiation into effector cells; lymphokine secretion from the effector cell contributes to the adaptive immune response (1;3;4;26). The T cell originates in the bone marrow as a hematopoietic stem cell that, upon expression of cell surface markers such as c-Kit, CD44 and CD25, transitions to a common lymphoid progenitor. Migration of the T-cell progenitor from the bone marrow to the thymus facilitates its maturation and positive selection via recognition of a foreign peptide presented by a self MHC protein. Two classes of T cells can be activated upon detection of an antigen, helper T cells, and cytotoxic T cells. The helper T cells activate other cells such as macrophages, B cells, and the cytotoxic T cells while the cytotoxic T cells act directly on the cells that are infected. Efficient T cell activation, maturation, and migration are essential to remove invading pathogens and to maintain self-tissue tolerance. Improper thymocyte development/maturation are observed in autoimmune disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), transplant rejection, and chronic viral infections (4;27;28). There are two transmembrane protein units on the T cell that are essential for the activation of intracellular signaling upon recognition of an MHC peptide during an adaptive immune response: the CD4 (see thoth) or CD8 co-receptors and the TCR-CD3 complex (3) (Table 1). Table 1: TCR-CD3 complex units and their functions
Helper T cells display CD4 on their cell surface and produce a subset of cytokines (lymphokines) through the initiation of intracellular signaling upon the recognition of MHC class II molecules on APCs. CD8-presenting cells are cytotoxic T cells and promotes the death of the infected cell upon recognition of MHC class I molecules on APCs (6). During thymocyte maturation, the earliest T cell precursor is a CD4/CD8 double negative (DN) lymphoid cell (4). As maturation progresses, the DN cell signals the T cell to proceed to either a TCRα/β or a TCRδ/γ cell lineage and to further differentiate to a CD4+/CD8+ double positive (DP) cell (4).
Within the TCR-CD3 complex, the TCR heterodimer determines antigen specificity by recognizing and binding the MHC-bound peptide (12;14). The TCR heterodimer is usually comprised of an α and β chain; δ/γ heterodimers comprise ~2% of the complexes, mostly on intraepithelial lymphocytes. Both the cytotoxic and helper T cells consist of a TCR heterodimer that are encoded by site-specific recombination of V, D, and J gene segments during T cell development in the thymus. The CD3 complex (the CD3ε/γ, ε/δ heterodimers, and the CD3ζ/ζ homodimer (or CD3ζ/η heterodimer)) facilitates intracellular TCR-CD3 complex assembly and its subsequent surface expression. In addition, the CD3 complex promotes T cell receptor-mediated signaling (i.e. antigen recognition activating thymocyte differentiation) by interactions with different intracellular adaptors and kinases (1;4;13;15;29;30). Analysis of the function of CD3η within the CD3ζ/η heterodimer has not been conclusive. Some studies indicate that the η chain is essential for phosphatidylinositol (PI) hydrolysis and activation-induced apoptosis of T cell hybridomas (31;32). Hydrolysis of PI to inositol-1,4,5-triphosphate (IP3) and diacylglycerol affects NF-AT and NF-κB transcription factor activation, respectively (33). PI hydrolysis, along with an increase in intracellular calcium, are prerequisites for the induction of cytokines such as IL-2 following TCR activation (33). In contrast to the findings that CD3η has an essential role upon T cell receptor activation, other studies have shown that PI hydrolysis is induced by TCR complexes containing a ζ homodimer (34;35) and that mice homozygous for a mutation inactivating the CD3η gene developed normal thymocytes and mature T cells (7). The CD3ζ chains have several documented functions:
The loss of Cd247 expression has been implicated in several human diseases. Examination of the T cells from several patients with SLE found that their cells expressed lower levels of CD3ζ or that it was not phosphorylated (10;28). In these cells, the TCR-CD3 complex recruited spleen tyrosine kinase (Syk) instead of ZAP-70 after receptor activation (10); Syk-related signaling promotes increased phosphorylation and calcium influx into the cells, but IL-2 expression is not induced (10). In another study, RT-PCR examination of the CD3ζ transcript sequence from several patients found either portions of exon 7 were deleted or point mutations within an ITAM domain (28). The T cells in patients with abnormal expression of CD3ζ but normal expression of the other TCR-CD3 complex members had impaired immune response to alloantigens, tetanus toxoid, and mitogens (OMIM: #610163). In other patients, a Q70X mutation in Cd247 led to primary T-cell immunodeficiency (40). Interestingly, in some patients with cancer, CD3ζ expression on T cells was reduced, leading to a loss in TCR-mediated signal transduction (14). Aberrant expression of Cd247 has also been implicated in hypertension (41), celiac disease, and rheumatoid arthritis (42). | |||||||||||||||||||||||||||||||||||
Putative Mechanism | The A225T mutation in exon 2 of Cd247 generates a D36V mutation in the CD3ζ and CD3η proteins. D36 of CD3ζ and CD3η is within the transmembrane domain, an essential domain for protein interactions between the TCR and CD3 subunits (4;5;15). The charge of D36 in the transmembrane domain has been shown to be essential for protein-protein interactions (5). Also, the transition from a negative to a neutral charge at this residue may lead to: (i) a change in the conformation of the chain within the lipid bilayer of the membrane, decreasing its stability, (ii) alterations in the interactions with the other members of the TCR-CD3 complex, and/or (iii) retention of CD3ζ and CD3η in the ER and their subsequent degradation. Previous studies on CD3ε have shown that changes in the charge of its transmembrane domain (at residue 8) leads to ER retention and degradation in the ER (43). | |||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||
Genotyping | Allia genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change. The following primers are used for PCR amplification: Primers for PCR amplification Allia(F): 5’-ATGTCACCAGAGCAGAAGTTCTGTG-3’ Allia(R): 5’-GCCCTAAGAAGAGGCTGTCTTGTC-3’ Primers for sequencing Allia_seq(F): 5’-TCTGTCACAGAATTGACCTGG-3’ Allia_seq(R): 5’-TGTCTGCCACAGATGGATAC-3’ PCR program 1) 94°C 2:00 2) 94°C 0:30 3) 57°C 0:30 4) 72°C 1:00 5) repeat steps (2-4) 29x 6) 72°C 7:00 7) 4°C ∞ The following sequence of 1042 nucleotides (from Genbank genomic region NC_000067 for linear genomic sequence of Cd247) is amplified: 65821 atgtcaccaga 65881 gcagaagttctgtgcacagcagtttcattttttcctaatactccctcattcttcccagcc 65941 tctgtggttacatctggtacatgtggttacattgtatgcatataggtgcactccttacat 66001 ctggtacattggttacattgtatgcataggtgcactccttacatctggtacatgtggtta 66061 cattgtatgcataggtgcactcgttacatctggtacaagtggttacattgtatgcatata 66121 ggtgcactccttacatctggtacatgtggttacattgtatgcattggttcactcattaca 66181 tctggtacatgtggttacattgtatgcattggtgcactcgttacatctggtacatgtggt 66241 tacattgtatgcataggtgcactctttacatctggtacatgtggttacattggccattgc 66301 aggctgggtttcttcagactcagtgagagaggttgtaggttgtggtctgtgtgaagtatg 66361 aggactggacctagtgcccgtgacatgactacaatctgtcacagaattgacctggggtag 66421 gtgggatgtgttcttgccagatccagcatgcctaaccaattttctctcttggcacagagg 66481 cacagagctttggtctgctggatcccaaactctgctacttgctagatggaatcctcttca 66541 tctacggagtcatcatcacagccctgtacctgagagcaaaagtgggttcccctgggctct 66601 tgagggagggtataggttcctccactgggaggatgtgaggtggggatttggcactggaga 66661 gtctcaggcctgtgctctgcttggtgtccatgggcaaggcaggatacaaccaagcgtgca 66721 cagccggtgagcagagaaggcggggtatccatctgtggcagacagagcagctcaatgatc 66781 caagtgctatgtgtattactgaagatcggtaccagtgcctggatgtggcttctgctggga 66841 aacagatggcttatactgaacagtttaggacaagaaagtgaaagacagacaagacagcct 66901 cttcttagggc Primer binding sites are underlined; sequencing primers are highlighted; the mutated A is highlighted in red. | |||||||||||||||||||||||||||||||||||
References | ||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | |||||||||||||||||||||||||||||||||||
Illustrators | Victoria Webster | |||||||||||||||||||||||||||||||||||
Authors | Owen Siggs, Sara Kalina |