Phenotypic Mutation 'Lps2' (pdf version)
AlleleLps2
Mutation Type small deletion
Chromosome17
Coordinate56,271,577 bp (GRCm38)
Base Change C ⇒ (forward strand)
Gene Ticam1
Gene Name toll-like receptor adaptor molecule 1
Synonym(s) TICAM-1, Trif
Chromosomal Location 56,269,319-56,276,786 bp (-)
MGI Phenotype Homozygous null mice are viable but exhibit abnormalities of the innate immune system.
Accession Number

NCBI RefSeq: NM_174989; MGI: 2147032

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Ref Sequences
Ensembl: ENSMUSP00000055104 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
low complexity region 345 384 N/A INTRINSIC
low complexity region 622 679 N/A INTRINSIC
Phenotypic Category DSS: sensitive day 7, immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages, TLR signaling defect: type I IFN production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(2) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense probably benign 0.12
IGL02164:Ticam1 APN 17 56270019 missense unknown
Pangu UTSW 17 56276693 critical splice donor site probably damaging 0.98
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R4982:Ticam1 UTSW 17 56272020 missense probably benign 0.10
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5604_K:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5604_Q:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice, Embryos, Sperm, gDNA
Repository

JAX: 005037 (C57BL/6-Ticam1Lps2)

Last Updated 04/06/2017 12:57 PM by Katherine Timer
Record Created unknown
Record Posted 10/29/2007
Phenotypic Description
Figure 1. (a-g) TNF responses of Lps2 macrophages to various TLR ligands. Both Lps2 heterozygous and homozygous macrophages show decreased responses to the TLR4 ligands Lipid A (a) and LPS (b), the TLR3 ligand poly(I:C), but normal responses to the TLR2 ligand Pam3CSK4 (d), the TLR7 ligand resiquimod (e), the TLR9 ligand CpG DNA (f), and the TLR2/6 ligand peptidoglycan (g). LPS-induced cytotoxicity is shown in (h). Values represent means s.e.m. (n=6 mice). Figure reproduced from reference (2).

Lps2 was the first immunological phenotype identified in an ENU-induced mutagenesis screen designed to detect aberrant cytokine responses to Toll-like receptor (TLR) agonists (TLR Signaling Screen) (1;2).  Peritoneal macrophages isolated from the mutant showed markedly diminished tumor necrosis factor (TNF)-α production in response to lipopolysaccharide (LPS) and lipid A, which signal via TLR4, and poly I:C (a dsRNA mimetic), which signals through TLR3. In contrast, stimulation with Pam3CSK4 (triacyl lipopeptide), peptidoglycan, resiquimod (a ssRNA mimetic) and unmethylated CpG oligodeoxynucleotides (CpG ODN) resulted in normal TNF-α production, indicating that signaling via TLRs 1, 2, 6, 7, and 9 was not affected by the Lps2 mutation. Similarly, signaling through TLR2/6 heterodimers, using zymosan as an inducer, was normal. In addition, LPS-induced macrophage toxicity was abrogated in the mutant. Heterozygous Lps2 mice displayed partially defective responses to LPS, lipid A and poly I:C, indicating that the mutant allele is semidominant, or that the wild type allele is haploinsufficient (Figure 1).

Homozygous Lps2 mutants are hypersusceptible to infection with mouse cytomegalovirus (MCMV), as demonstrated by the following: 1) they display a 1000-fold higher splenic viral titer than wild type mice after intraperitoneal inoculation, 2) they succumb to MCMV infection over a range of inocula that do not kill wild type mice, and 3) they fail to produce type 1 interferon (IFN) after infection (MCMV Susceptibility and Resistance Screen).
 
The Lps2 mutation also affects the adjuvanticity of LPS (3). Lps2 macrophages fail to upregulate the costimulatory molecules CD40, CD80, and CD86, as well as major histocompatibility complex (MHC) class II molecules in response to LPS. Upon intraperitoneal immunization with two immunodominant OVA peptides along with LPS as an adjuvant, proliferation of antigen-specific CD4+ T cells or expansion of antigen-specific effector CD8+ T cellsdoes not occur in Lps2 homozygotes. Surprisingly, Lps2 mice still upregulate costimulatory molecules induced by poly I:C (as do Tlr3-/- mutants). It is now known that the IFN-inducible protein mda-5 (melanoma differentiation-associated gene 5) is able to detect poly I:C, and presumably, is an alternative receptor capable of mediating adjuvant effects (4).
Nature of Mutation
The Lps2 mutation was mapped to Chromosome 17, and corresponds to a single nucleotide deletion of a G at position 2258 (in exon 2 of 2 total exons), causing a frameshift which deletes 24 amino acids from the C-terminus of the protein and replaces them with 11 unrelated amino acids followed by a premature stop.
 
2241 CAGTCATCTGATGACAAGACTGAGTGTTCGGAGAACCCCTGTATGGGCCCTCTGA
703  -Q--S--S--D--D--K- -L--S--V--R--R--T--P--V--W--A--L--*
          correct                   aberrant
 
The deleted G is indicated in red lettering within the cDNA sequence (Genbank Accession NM_174989). The aberrant amino acids encoded by the frame-shifted DNA sequence are shown.
Protein Prediction

Figure 2. TICAM-1 (alternatively, TRIF) is a 732-amino acid protein that contains an N- and C-terminal proline-rich domain (PR).  TRIF contains a 200 amino acid Toll/IL-1 receptor (TIR) domain. TRIF has three TRAF6 binding motifs at the N-terminus. The Lps2 mutation alters 24 C-terminal amino acids that may subsuently destabilize or inactivate the mutant protein (pink box). Locations of domains/motifs are from Uniprot: Q80UF7. Click on the image to view other mutations found in TICAM-1. Click on each mututation for more specific information.

Ticam1 encodes the 732-amino acid protein TICAM-1 [Toll-interleukin 1 receptor (TIR) domain-containing adaptor molecule-1; hereafter TRIF (TIR domain-containing adaptor inducing IFN-β)], an adaptor in TLR3 and TLR4 signaling (Figure 2). In human TRIF, the N- and C-termini contain proline-rich domains (5); only the C-terminal proline-rich domain is conserved in mouse Trif (6). TRIF also contains a Toll/IL-1 receptor (TIR) domain, a conserved region of approximately 200 amino acids which mediates homo- and heterotypic protein interactions during signal transduction (5;7). TIR domains in TLRs, IL receptors and the adaptors MyD88 and TIRAP contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (8). However, conserved sequences in boxes 1, 2 and 3 are lacking in Trif. Specifically, the (F/Y)D in box 1, RD in box 2 and FW in box 3 are missing in Trif (5). TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops. The crystal structures of the TLR1 and TLR2 TIR domains revealed that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (9). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4, which abolishes MyD88 binding (10) and LPS-induced signaling in mice (11). This proline residue is conserved in Trif. Trif differs from MyD88 in that it lacks a death domain (5;7), which in MyD88 recruits IL-1 receptor associated kinase (IRAK) family proteins (12). Trif reportedly harbors between one and three TNF receptor-associated factor-6 (TRAF6) binding motifs at its N-terminus (13;14), defined by the sequence P-X-E-X-X-acidic/aromatic (15). When co-transfected into HEK 293 cells, TRIF and TRAF6 can be co-immunoprecipitated (13;14). Mutant TRIF constructs in which E252 or all three glutamate residues in the putative TRAF6 binding motifs are mutated to alanine cannot be co-immunoprecipitated with TRAF6, and fail to activate an NF-κB luciferase reporter (13;14). However, recent data obtained using TRAF6-/- macrophages demonstrate that TRAF6 is not required for TRIF-dependent NF-κB activation (16), suggesting that the TRIF-TRAF6 interaction has a separate, yet unknown function, or that in TRAF6-/- cells another protein can fulfill this role.

 
The Lps2 mutation replaces the C-terminal 24 amino acids of Trif with 11 improper amino acids. It has been noted that the 19 C-terminal residues of mouse Trif are not represented in the human homologue, although the human protein is functional in when transfected into cells (2). The addition of 11 aberrant amino acids may destabilize or inactivate the mutant protein (2).
Expression/Localization

Northern blot analysis of human tissues revealed that Trif is expressed ubiquitously (5;7). Among immune cells, Trif is expressed in immature dendritic cells (iDC), macrophages and natural killer (NK) cells (5). Trif is localized in the cytoplasm (17).

 
Background
TLRs are transmembrane receptors that sense molecules of microbial origin and trigger host cell responses. The twelve mouse TLRs and ten human TLRs recognize a wide range of structurally distinct molecules, and all signal through only four adaptor proteins known to date: MyD88, Tirap (Mal), TICAM-1 (TRIF) and TRAM (18). TLR signaling through these adaptors initiates a cascade of signaling events involving various kinases, adaptors and ubiquitin ligases, ultimately leading to transcriptional activation of cytokine and other genes through the transcription factors NF-κB, AP-1, interferon responsive factor (IRF)-3, and IRF-7.
 
Although MyD88 is common to signaling pathways activated by almost all the TLRs, the existence of a MyD88-independent pathway was evidenced by the intact (but slightly delayed) LPS-dependent activation of NF-κB, JNK and MAP kinases in MyD88-deficient macrophages (19). MyD88-deficient dendritic cells (DC) can also activate NF-κB and MAP kinase (20); this leads to functional maturation of MyD88-deficient DCs as shown by upregulation of costimulatory molecules and enhancement of APC activity (3;21). Furthermore, the MyD88-independent pathway was demonstrated to stimulate phosphorylation and nuclear translocation of IRF-3, IRF-3 binding to interferon-stimulated response elements (ISRE), and transcription of interferon-inducible genes (20;22). These findings prompted the search for TIR domain-containing adaptors that could mediate such MyD88-independent TLR signaling.
 
Initially, the MyD88-independent pathway was attributed to Tirap (23;24). However, subsequent study of Tirap-deficient mice demonstrated that their macrophages display the same intact but delayed LPS-dependent activation of NF-κB, JNK and MAP kinases observed in MyD88-deficient macrophages (25;26). In addition, expression of interferon-inducible genes and DC maturation is still observed in Tirap-null and MyD88-/-Tirap-/- double knockout mice (26). Together, these data indicate that Tirap does not mediate MyD88-independent TLR4 signaling, but that Tirap functions with or in parallel to MyD88. Tirap has been shown to form heterodimers with MyD88, in agreement with this possibility (24).
 
Trif was first identified using a sequence homology search for other TIR domain-containing adaptors (7), and by yeast two-hybrid screening using the intracellular domain of TLR3 as bait (5). Trif activates transcription of a reporter controlled by the IFN-β or NF-κB promoters in transfected HEK 293 cells (5;7). However, it was unclear whether Trif served as an adaptor for all TLRs (7) or only for TLR3 (5).

 

Putative Mechanism
Study of the Lps2 strain, and subsequently of Trif-/- mice, demonstrated that primarily two adaptors, Trif and MyD88, act in LPS-induced TLR4 signaling leading to NF-κB and IRF-3 activation, and upregulation of costimulatory molecules (2;3;27). While Lps2 and Trif-/- cells can activate JNK, MAP and NF-κB, double mutant TrifLps2/Lps2My88-/- or Trif-/-MyD88-/- cells display no JNK, MAP or NF-κB activation (2;27). Thus, both Trif and MyD88 can activate NF-κB independently, and deficiency of both proteins is necessary to abrogate this response. [Compound TrifLps2/Lps2My88-/- mutants show no response to any TLR ligands except dsRNA (2;27;28).] IRF-3 activation requires Trif alone, not MyD88, as evidenced by the failure of Lps2 or Trif-/- cells to activate interferon-inducible genes in response to LPS (2;27), while MyD88-null cells do so normally (19;22). Upregulation of costimulatory molecules has also been attributed to Trif, since Lps2 macrophages do not upregulate costimulatory molecules CD40, CD80 or CD86 in response to LPS, although MyD88-deficient cells do so normally (3).
 
Figure 3. TICAM signaling pathways. In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM recruits polyubiquitinated RIP2, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN produciton through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKε; RIP1 is not required for TICAM-dependent activation of IRF3. Internalized TLR4 in late endosomes signals through the TICAM-dependent pathway. While on the cell surface, TLR4 can signal through TRAM to induce IRF7 activation in reponse to vesicular stomatitis virus glycoprotein G (VSV-G). This process is partially dependent on TICAM.
It is now understood that the MyD88-dependent pathway induces an early-phase activation of NF-κB and MAP kinases, while the Trif-mediated MyD88-independent pathway induces a late-phase activation of NF-κB and MAP kinases (Figure 3). This implied that the MyD88 and Trif pathways converged at some point distal to MyD88 and Trif, but proximal to NF-κB activation. Initial studies provided evidence that Trif binds to TRAF6 (13;14), an E3 ubiquitin ligase that also coordinates the activation of several kinases including TAK-1, and in turn MAP kinases and the IKK complex leading to NF-κB activation. It had been thought that all TLR pathways are mediated by TRAF6, including the TRIF-dependent activation of NF-κB. However, recent studies showed that the LPS-stimulated induction of NF-κB in TRAF6-/- cells follows the delayed kinetics observed in MyD88-deficient cells (16). In addition, expression of the interferon-inducible gene IP10 and upregulation of the costimulatory molecule CD86 occurs normally in response to LPS in TRAF6-/- macrophages (16). Thus, TRAF6 is not required for TLR4, Trif-dependent signaling, and the convergence of the MyD88-dependent and –independent pathways must lie downstream of TRAF6.
 
Despite the integrity of the pathway from TLR4 to NF-κB and MAP kinase activation in MyD88- and Trif-deficient mutants, LPS-induced responses clearly require both adaptors for optimal function. Although deficiencies in both MyD88 and Trif are required to completely abrogate LPS-induced JNK, MAP and NF-κB activation, LPS-induced cytokine production is nearly abolished in Trif mutants (2;27;28), and Lps2 mice are hypersusceptible to MCMV infection (2).
 
In addition to Trif, the protein TRAM (TRIF-related adaptor molecule) also serves as an adaptor in MyD88-independent TLR4 signaling stimulated by LPS (2;29). Its existence was postulated when a population of homozygous Lps2 macrophages was observed to produce low levels of TNF-α in response to LPS, but not poly I:C (2). Originally called “adaptor X” and hypothesized to be a TRIF homologue on mouse Chromosome 18, it was confirmed to be the TRAM protein by targeted deletion in mice (2;29). TRAM-/- macrophages fail to produce TNF-α and IL-6 in response to LPS, but not peptidoglycan, R-848 (TLR7 ligand), or CpG ODN (29). Both LPS- and poly I:C-stimulated NF-κB activation is normal in TRAM-/- cells. In contrast, poly I:C, but not LPS, induces expression of IFN-inducible genes in TRAM-/- cells (29). Thus, together with TRIF, TRAM specifically mediates the MyD88-independent pathway of TLR4 signaling.
 
Trif-mutant mice also revealed that Trif is the only adaptor serving TLR3 (2;27). Lps2 or Trif-null macrophages fail to activate NF-κB or IRF-3, or induce IFN-β in response to poly I:C (2;27). TRAF6 is also not required for TLR3, Trif-dependent signaling, since poly I:C-stimulated (Trif-dependent) activation of MAP kinase, IFN promoter and TNF-α production is normal in TRAF6-/- macrophages (16).

 

Primers Primers cannot be located by automatic search.
Genotyping
Lps2 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide deletion. The same primers are used for PCR amplification and for sequencing.
 
Primers
Lps2(F): 5’-ACAGTCCCAATCCTTTCCATCAGC-3’
Lps2(R): 5’-AGGATTCAGATTGGAGTCCCACAGTC-3’
 
PCR program
1) 94°C                            2:00
2) 94°C                            0:30
3) 55°C (annealing)           0:30
4) 72°C                            0:45
5) repeat steps (2-4) 34X
6) 72°C                            7:00
7) 4°C                              ∞
 
The following sequence of 476 nucleotides all within one exon (from Genbank Accession NC_000083) is amplified:
 
2111            acagtcccaa tcctttccat cagcctcctc cccagcccca cagactccag
2161 gacctcagcc tctcattatt caccatgccc agatggttca gctgggtgtc aacaatcaca
2221 tgtggggcca cacaggggcc cagtcatctg atgacaagac tgagtgttcg gagaacccct
2281 gtatgggccc tctgactgat cagggcgaac cccttcttga gactccagag tgaccaggtt
2341 ggaccccacc tagatggcta gagtgacaag attggacttc acctgggtcc ttaaaatgat
2401 agtggaggaa gggaacctcg cctgggtccc cagagtagcc agaggactta gcttgggctc
2461 cacagtggct attagttgga cccagcttga gaccccagag gcagggaaga ccacacctat
2521 aaatcaggcc tgggaaacat gcagaaaccc catttgaaca gactgtggga ctccaatctg
2581 aatcct
 
Primer binding sites are underlined; the deleted G is shown in red text.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKasper Hoebe, Bruce Beutler
Edit History
09/08/2010 11:06 AM (current)
05/25/2010 12:14 PM
05/25/2010 11:49 AM
05/25/2010 11:48 AM
02/11/2010 9:48 AM