Incidental Mutation 'R0047:Trmt11'
ID15968
Institutional Source Beutler Lab
Gene Symbol Trmt11
Ensembl Gene ENSMUSG00000019792
Gene NametRNA methyltransferase 11
Synonyms3110045I18Rik, 2410075D05Rik
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R0047 (G1)
Quality Score
Status Validated
Chromosome10
Chromosomal Location30534225-30600749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30535243 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 418 (N418S)
Ref Sequence ENSEMBL: ENSMUSP00000019927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019927] [ENSMUST00000215595]
Predicted Effect probably benign
Transcript: ENSMUST00000019927
AA Change: N418S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019927
Gene: ENSMUSG00000019792
AA Change: N418S

DomainStartEndE-ValueType
Pfam:UPF0020 189 324 1.9e-14 PFAM
Pfam:Methyltransf_26 216 373 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214092
Predicted Effect probably benign
Transcript: ENSMUST00000215595
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 89.2%
  • 3x: 86.3%
  • 10x: 78.8%
  • 20x: 65.9%
Validation Efficiency 95% (110/116)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Cacna1d T G 14: 30,346,790 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Gm3333 A G 13: 62,274,471 noncoding transcript Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Psg-ps1 A G 7: 17,677,881 noncoding transcript Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Sptb G T 12: 76,622,950 Q535K probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Other mutations in Trmt11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trmt11 APN 10 30566449 missense probably damaging 1.00
IGL01586:Trmt11 APN 10 30597751 missense probably benign 0.01
IGL02307:Trmt11 APN 10 30594154 missense possibly damaging 0.92
IGL02319:Trmt11 APN 10 30560873 missense probably damaging 1.00
IGL02622:Trmt11 APN 10 30559173 missense probably benign 0.00
R0047:Trmt11 UTSW 10 30535243 missense probably benign
R0269:Trmt11 UTSW 10 30587489 missense probably benign 0.01
R1240:Trmt11 UTSW 10 30590825 intron probably benign
R1694:Trmt11 UTSW 10 30535225 missense probably benign 0.02
R1765:Trmt11 UTSW 10 30559188 missense probably benign
R2293:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2295:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R2857:Trmt11 UTSW 10 30547748 missense probably damaging 0.98
R4631:Trmt11 UTSW 10 30559204 missense probably benign 0.00
R5684:Trmt11 UTSW 10 30547710 missense probably damaging 1.00
R5952:Trmt11 UTSW 10 30560842 missense probably benign 0.01
R6022:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
R7044:Trmt11 UTSW 10 30590934 missense probably benign 0.27
R7459:Trmt11 UTSW 10 30590043 missense probably benign 0.02
R7538:Trmt11 UTSW 10 30560874 missense probably damaging 1.00
R7672:Trmt11 UTSW 10 30587524 missense probably damaging 1.00
R7728:Trmt11 UTSW 10 30587501 missense possibly damaging 0.76
Nature of Mutation

Whole genome SOLiD sequencing identified 61 mutations in the stock mouse. Three G3 mice with the butchered mutation were genotyped at all 61 mutation sites and one mutation on chromosome 10 was homozygous in all three mice. Capillary sequencing of the mutated gene identified a A to G transition at base pair 30255049 (NCBIm37) on chromosome 10 in the GenBank genomic region NC_000076 encoding Trmt11. The mutation corresponds to residue 1253 in exon 13 of 13 total exons.

 

1233 AAAGGTGAAGGAATTTGAGAACCGGGACAAGTATTCACAC      

411  --K--V--K--E--F--E--N--R--D--K--Y--S--H-

 

The mutated nucleotide is indicated in red.  The mutation results in a substitution of asparagine (N) to a serine at residue 418.

Protein Function and Prediction

Trmt11 encodes the 460 amino acid tRNA guanosine-2'-O-methyltransferase (MTase) TRM11 homolog, Trmt11/Trm11.  Trmt11, along with all DNA MTases (and most RNA MTases), is a class I Rossman fold-like MTase (1;2). The class I Rossman fold-like MTases are comprised of a seven-stranded β-sheet surrounded by helices (3). The Rossman fold serves as a RNA interacting domain (4;5) and have nine common motifs (2). Motifs I and III are involved in binding of the cofactor S-adenosyl-l-methionine (AdoMet); motifs IV, VI, VIII, and X are often involved in binding to the target nucleotide and in the methyl transfer reactions (2). In yeast Trm11p (the homolog of mouse Trm11), Asp215 in motif I was identified as involved in AdoMet binding, while Asp291 in motif IV was identified as a residue essential for MTase catalytic activity (2). MTase activity in yeast strains with mutations at Asp215 or Asp291 both lost MTase activity, indicating that both residues are needed for Trm11p MTase activity (2). The putative active site in yeast Trm11p is within motif IV and exhibits a variant (DPPY) of the [D-N-S]-P-P-[Y-F-W-H] motif, a exocyclic amino acid modifying tetrapeptide motif found in most MTases (6;7).

 

The motifs of the Rossman fold that include the AdoMet-binding and catalytic residues comprise the Pfam UPF0020 domain (PF01170; aa 188-335, SMART), a catalytic domain common to MTases and one that is typically associated with the 100-110 amino acid RNA-binding N-terminal THUMP (thiouridine synthases, RNA methyltransferases, and pseudouridine synthases) domain (2;8;9).  However, Ensembl and SMART did not predict the presence of a THUMP domain in mouse Trmt11. The THUMP domain shares a common α/β fold among different MTases in several species (9) and is proposed to function in the interaction of specific regions of tRNA as well as in targeting the catalytic domain towards the central core of the tRNA molecule (8). Structural studies determined that the THUMP domain recognizes the 3D structure of the tRNA molecule as opposed to a specific sequence (10).

 

The butchered mutation at residue 418 does not occur in the MTase or putative THUMP domain. A putative domain and function for the C-terminal region following the MTase domain is not known.

Expression/Localization

Expression and localization of Trmt11 have not been determined in the mouse or human. BioGPS predicts that in the mouse, Trmt11 is ubiquitously expressed.  Higher levels are predicted in immune cells such as NK cells, osteoclasts and mast cells. In yeast, Trm11p is expressed throughout the cytoplasm and is mostly excluded from the nucleus (2).

 

tRNA MTase 11-2 (Trmt112), a gene that encodes an interacting partner of Trmt11 (see the “Background” section, below), is highly expressed in the developing mouse brain and neural tubes at embryonic day (E)10.5-11.5 (11). At E13.5, Trmt112 is abundantly expressed in a variety of neural epithelium, Rathke’s pouch, medulla oblongata and dorsal root ganglia (11).

Background

After transcription by RNA polymerase III and before becoming functional, tRNAs undergo several posttranscriptional modifications during maturation including the removal of leader and trailer sequences, the addition of a CCA at the 3′ end, and the modification of ~10% of the nucleotides (base and ribose methylations are the most common) (11-15). Methylation functions to alter the tRNA’s codon specificity, protects against endonucleases, and/or stabilizes the tRNA tertiary structure (10). Base methylations of cytoplasmic tRNAs occur at positions 9, 10, 26, 32, 34, 37, 40, 46, 48, 49, 54, and 58; cytoplasmic tRNAs also contain 2′-O-methylriboses at positions 4, 18, 32, 34, and 44 and 15 (2). Methylations at these sites typically occur by the activity of a unisite-specific enzyme; in yeast, Trm4p (16) and Trm7p (17) are multisite-specific base and ribose MTases, respectively.

 

The functions of several tRNA MTases have been examined in yeast. For example, the heterodimer formed between Trm6p and Trm61p facilitates the formation of m1A58 and is essential for cell growth (18). Also, growth defects were observed upon deletion of either Trm5 or Trm7 (19;20); deletion of the other known Trm genes did not lead to cell growth defects (2).  In mammals (specifically, humans), only a few human tRNA MTases have been characterized [reviewed in (21)]. For example, Trmt61B has been identified as a methyltransferase that facilitates the formation of m1A58 in human mitochondrial tRNAs (22). Similar to yeast, Trmt61A forms a heterodimer with Trmt6 (22).

 

The function of mammalian Trmt11 is currently unknown. In yeast, Trmt11/Trm11p is the catalytic subunit of a complex (with Trm112/Trm112p, a zinc-binding protein) that catalyzes the methyl transfer from AdoMet to the N2 atom of guanine at position 10 (G10) in tRNA to generate N2-methylguanine at position 10 (m2G10) (2;23;24).  The m2G10 position in tRNA subsequently forms a tertiary base pair with the C25 and C45 bases (25;26). Both subunits are required for the formation of m2G10, but the precise function of the Trm112p subunit is unknown (2). Trm112p also interacts with Trm9p [a methyltransferase that modifies uridines at the wobble position in tRNA (27)], Mtc6p, and Lys9p [regulates the lysine biosynthetic pathway in yeast (28)] (24); deletion of Trm112 leads to severe growth defects (deletion of Trm11 does not), indicating that Trm112 has multiple functions in the cell (2). Due to the expression pattern of Trmt112 in mouse (see the “Expression/Localization” section, above), Gu et al. propose that Trmt112 functions in the developing brain and nervous system as well as in the morphogenesis of diverse tissues (11). Purushothaman et al. determined that Trm11p also interacts with Trm1 in yeast.  Trm1 catalyzes the formation of m22G26 in both cytoplasmic and mitochondrial tRNA by using AdoMet as a substrate (29-31). Deletion of both Trm11 and Trm1 leads to a slow-growth phenotype in yeast that is proposed to be due to loss of the modifications at position 10 and 26 (2).

 

TRMT11 expression and androgen deprivation therapy in prostate cancer

In the initial stages of prostate cancer, patients are often given androgen deprivation therapy (ADT) (32). In order to determine if there are genetic determinants in ADT failure, Kohli et al. examined genetic variations implicated in sex steroid hormonal biosynthetic and metabolic pathways in prostate cancer patient cohorts receiving ADT (32). TRMT11 was one of three genes that were significantly different in the cohorts with ADT failure (32).  Furthermore, two (of four) TRMT11 tagSNPs were significant for time to ADT therapy failure; a protective effect was observed in the presence of 0, 1, or 2 minor alleles for the two SNPs (32). The results from this study indicate that variation in TRMT11 expression could function as a germline predictive marker for ADT failure (32). A link between a putative TRMT11 function and ADT failure was not examined.

 

tRNA modification and immune responses

The role of RNA modifications (including methylation) on the immune response has been examined. The higher frequency of RNA modifications in eukaryotic versus prokaryotic/viral RNA is proposed to allow the discrimination of foreign RNA from self-RNA (33-35). In addition, pathogens can use nucleotide modifications to allow for immune evasion (35). For example, the 2′-O-methylation of viral mRNA cap structures by virus-encoded MTases leads to decreased type I interferon (IFN) production (36;37). In addition, Kariko et al. determined that the immunostimulatory potential of synthetic RNA can be negatively regulated by changes in RNA 2′-O-methylation and base methylation (e.g., m5C, m6A, m5U, and s2U) (34). Dendritic cells exposed to the above-mentioned modified RNAs produced less cytokines than those treated with unmodified RNA (34). Also, random incorporation of the above-mentioned modifications into in vitro transcripts of messenger RNAs prevented the stimulation of TLRs (33).

 

Studies have determined that tRNA is a relevant RNA species in immune recognition (35;38). Modification of tRNA at guanosine 18 (G18) has recently been identified as essential for tRNA-mediated activation of Toll-like receptor 7 (TLR7; see the records for rsq1 and rsq2 for more details about Tlr7) (35), a receptor that was previously identified as a receptor for single-stranded RNA (39). G18 is a highly conserved residue in the D loop of tRNA that interacts with a pseudouridine at position 55 to stabilize the L-shaped structure of tRNA; G18 is methylated at the 2′-O-position by the Gm18-2′-O-methyltransferase, spoU/trmH (35). Jockel et al. determined that TLR7 is the specific innate immune receptor for tRNA that is methylated at the 2′-O-position at G18 (35). G18-methylated tRNA inhibited influenza A virus-mediated IFN production, indicating that 2′-O-methylated tRNA has an immunological function (35). In addition, purified tRNA from six of nine strains of nonpathogenic, pathogenic, and probiotic strains belonging to the group of gram (+) bacteria (Lactococcus lactis and Bacillus subtilis), gram (−) bacteria (E. coli Nissle 1917, Haemophilus influenzae, Pseudomonas aeruginosa, and T. thermophilus), or the domain archaea (Methanothermobacter marburgensis) also induced IFN-α in human peripheral blood mononuclear cells (PBMCs) (35). Human PBMCs or wild-type mouse FLT3L-induced dendritic cells (DCs) exhibited a concentration-dependent production of type I IFN upon tRNA stimulation; IL-6, IL-12p40, and TNF were induced in TLR2/4 double-deficient DCs and enriched human monocytes (35). In TLR7-deficient FLT3L-DCs, IFN induction by tRNA did not occur (35). Although Kariko et al. determined that nucleoside modifications at m5C, m6A, m5U, s2U, or pseudouridine nucleoside modification repressed TLR7-mediated activation (34), Jockel et al. propose that it is the different types/sites of nucleoside modifications that mediate the phenotypes observed (35). A further example of this is that synthetic RNA oligonucleotides or siRNA with multiple 2′-O-methylations act as TLR7 antagonists (40;41) and can abolish TLR7-mediated immunostimulatory off-target effects (40;42). Taken together, the findings of Jokel et al. point to the 2′-O-methylation status of G18 as a determinant in TLR7 activation of inhibition (35).

 

A concurrent study by Gehrig et al. also examined the roles of tRNA modification (in particular, G18) on immune responses (38). This study determined that G18 is necessary and sufficient for immunosuppression in a classic tRNA macromolecule (38).  Furthermore, Gehrig et al. determined that G18 was not the singular self/non-self discriminator; Gm34 and tRNALys3 are also required modifications (38). Peripheral blood mononuclear cells stimulated with E. coli mutants lacking the G18 methyltransferase, trmH, exhibited increased stimulation, indicating that the enzyme may act as a virulence factor and that the G18 modification acts as an antagonist to TLR7-mediated responses (38). In agreement with the study by Jockel et al. (35), Gehrig et al. also determined that TLR7 stimulation in plasmacytoid dendritic cells is produced the tRNA-mediated production in IFN-α (38).

References
Posted On2013-01-08
Science WriterAnne Murray