Incidental Mutation 'R0047:Trmt11'

• ID: 15968
• Institutional Source: Beutler Lab
• Gene Symbol: Trmt11
• Ensembl Gene: ENSMUSG00000019792
• Gene Name: tRNA methyltransferase 11
• Synonyms: 2410075D05Rik, 3110045I18Rik
• MMRRC Submission: 038341-MU
• Essential gene?: Probably essential (E-score: 0.852)
• Stock #: R0047 (G1)
• Status: Validated
• Chromosome: 10
• Chromosomal Location: 30410221-30476745 bp(-) (GRCm39)
• Type of Mutation: missense
• DNA Base Change (assembly): T to C at 30411239 bp (GRCm39)
• Zygosity: Heterozygous
• Amino Acid Change: Asparagine to Serine at position 418 (N418S)
• Ref Sequence: ENSEMBL: ENSMUSP00000019927
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000019927] [ENSMUST00000215595]
• AlphaFold: no structure available at present
• Predicted Effect: probably benign; Transcript: ENSMUST00000019927; AA Change: N418S; PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
• SMART Domains: Protein: ENSMUSP00000019927; Gene: ENSMUSG00000019792; AA Change: N418S

Domain	Start	End	E-Value	Type
Pfam:UPF0020	189	324	1.9e-14	PFAM
Pfam:Methyltransf_26	216	373	1.2e-8	PFAM

• Predicted Effect: noncoding transcript; Transcript: ENSMUST00000214092
• Predicted Effect: probably benign; Transcript: ENSMUST00000215595
• Meta Mutation Damage Score: 0.0688
• Coding Region Coverage:
  • 1x: 89.2%
  • 3x: 86.3%
  • 10x: 78.8%
  • 20x: 65.9%
• Validation Efficiency: 95% (110/116)
• Posted On: 2013-01-08
• Science Writer: Anne Murray

Nature of Mutation

Whole genome SOLiD sequencing identified 61 mutations in the stock mouse. Three G3 mice with the butchered mutation were genotyped at all 61 mutation sites and one mutation on chromosome 10 was homozygous in all three mice. Capillary sequencing of the mutated gene identified a A to G transition at base pair 30255049 (NCBIm37) on chromosome 10 in the GenBank genomic region NC_000076 encoding Trmt11. The mutation corresponds to residue 1253 in exon 13 of 13 total exons.

1233 AAAGGTGAAGGAATTTGAGAACCGGGACAAGTATTCACAC      

411  --K--V--K--E--F--E--N--R--D--K--Y--S--H-

The mutated nucleotide is indicated in red.  The mutation results in a substitution of asparagine (N) to a serine at residue 418.

Protein Function and Prediction

Trmt11 encodes the 460 amino acid tRNA guanosine-2'-O-methyltransferase (MTase) TRM11 homolog, Trmt11/Trm11.  Trmt11, along with all DNA MTases (and most RNA MTases), is a class I Rossman fold-like MTase (1;2). The class I Rossman fold-like MTases are comprised of a seven-stranded β-sheet surrounded by helices (3). The Rossman fold serves as a RNA interacting domain (4;5) and have nine common motifs (2). Motifs I and III are involved in binding of the cofactor S-adenosyl-l-methionine (AdoMet); motifs IV, VI, VIII, and X are often involved in binding to the target nucleotide and in the methyl transfer reactions (2). In yeast Trm11p (the homolog of mouse Trm11), Asp215 in motif I was identified as involved in AdoMet binding, while Asp291 in motif IV was identified as a residue essential for MTase catalytic activity (2). MTase activity in yeast strains with mutations at Asp215 or Asp291 both lost MTase activity, indicating that both residues are needed for Trm11p MTase activity (2). The putative active site in yeast Trm11p is within motif IV and exhibits a variant (DPPY) of the [D-N-S]-P-P-[Y-F-W-H] motif, a exocyclic amino acid modifying tetrapeptide motif found in most MTases (6;7).

The motifs of the Rossman fold that include the AdoMet-binding and catalytic residues comprise the Pfam UPF0020 domain (PF01170; aa 188-335, SMART), a catalytic domain common to MTases and one that is typically associated with the 100-110 amino acid RNA-binding N-terminal THUMP (thiouridine synthases, RNA methyltransferases, and pseudouridine synthases) domain (2;8;9).  However, Ensembl and SMART did not predict the presence of a THUMP domain in mouse Trmt11. The THUMP domain shares a common α/β fold among different MTases in several species (9) and is proposed to function in the interaction of specific regions of tRNA as well as in targeting the catalytic domain towards the central core of the tRNA molecule (8). Structural studies determined that the THUMP domain recognizes the 3D structure of the tRNA molecule as opposed to a specific sequence (10).

The butchered mutation at residue 418 does not occur in the MTase or putative THUMP domain. A putative domain and function for the C-terminal region following the MTase domain is not known.

Expression/Localization

Expression and localization of Trmt11 have not been determined in the mouse or human. BioGPS predicts that in the mouse, Trmt11 is ubiquitously expressed.  Higher levels are predicted in immune cells such as NK cells, osteoclasts and mast cells. In yeast, Trm11p is expressed throughout the cytoplasm and is mostly excluded from the nucleus (2).

tRNA MTase 11-2 (Trmt112), a gene that encodes an interacting partner of Trmt11 (see the “Background” section, below), is highly expressed in the developing mouse brain and neural tubes at embryonic day (E)10.5-11.5 (11). At E13.5, Trmt112 is abundantly expressed in a variety of neural epithelium, Rathke’s pouch, medulla oblongata and dorsal root ganglia (11).

Background

After transcription by RNA polymerase III and before becoming functional, tRNAs undergo several posttranscriptional modifications during maturation including the removal of leader and trailer sequences, the addition of a CCA at the 3′ end, and the modification of ~10% of the nucleotides (base and ribose methylations are the most common) (11-15). Methylation functions to alter the tRNA’s codon specificity, protects against endonucleases, and/or stabilizes the tRNA tertiary structure (10). Base methylations of cytoplasmic tRNAs occur at positions 9, 10, 26, 32, 34, 37, 40, 46, 48, 49, 54, and 58; cytoplasmic tRNAs also contain 2′-O-methylriboses at positions 4, 18, 32, 34, and 44 and 15 (2). Methylations at these sites typically occur by the activity of a unisite-specific enzyme; in yeast, Trm4p (16) and Trm7p (17) are multisite-specific base and ribose MTases, respectively.

The functions of several tRNA MTases have been examined in yeast. For example, the heterodimer formed between Trm6p and Trm61p facilitates the formation of m¹A58 and is essential for cell growth (18). Also, growth defects were observed upon deletion of either Trm5 or Trm7 (19;20); deletion of the other known Trm genes did not lead to cell growth defects (2).  In mammals (specifically, humans), only a few human tRNA MTases have been characterized [reviewed in (21)]. For example, Trmt61B has been identified as a methyltransferase that facilitates the formation of m¹A58 in human mitochondrial tRNAs (22). Similar to yeast, Trmt61A forms a heterodimer with Trmt6 (22).

The function of mammalian Trmt11 is currently unknown. In yeast, Trmt11/Trm11p is the catalytic subunit of a complex (with Trm112/Trm112p, a zinc-binding protein) that catalyzes the methyl transfer from AdoMet to the N² atom of guanine at position 10 (G10) in tRNA to generate N²-methylguanine at position 10 (m²G10) (2;23;24).  The m²G10 position in tRNA subsequently forms a tertiary base pair with the C25 and C45 bases (25;26). Both subunits are required for the formation of m²G10, but the precise function of the Trm112p subunit is unknown (2). Trm112p also interacts with Trm9p [a methyltransferase that modifies uridines at the wobble position in tRNA (27)], Mtc6p, and Lys9p [regulates the lysine biosynthetic pathway in yeast (28)] (24); deletion of Trm112 leads to severe growth defects (deletion of Trm11 does not), indicating that Trm112 has multiple functions in the cell (2). Due to the expression pattern of Trmt112 in mouse (see the “Expression/Localization” section, above), Gu et al. propose that Trmt112 functions in the developing brain and nervous system as well as in the morphogenesis of diverse tissues (11). Purushothaman et al. determined that Trm11p also interacts with Trm1 in yeast.  Trm1 catalyzes the formation of m²₂G26 in both cytoplasmic and mitochondrial tRNA by using AdoMet as a substrate (29-31). Deletion of both Trm11 and Trm1 leads to a slow-growth phenotype in yeast that is proposed to be due to loss of the modifications at position 10 and 26 (2).

TRMT11 expression and androgen deprivation therapy in prostate cancer

In the initial stages of prostate cancer, patients are often given androgen deprivation therapy (ADT) (32). In order to determine if there are genetic determinants in ADT failure, Kohli et al. examined genetic variations implicated in sex steroid hormonal biosynthetic and metabolic pathways in prostate cancer patient cohorts receiving ADT (32). TRMT11 was one of three genes that were significantly different in the cohorts with ADT failure (32).  Furthermore, two (of four) TRMT11 tagSNPs were significant for time to ADT therapy failure; a protective effect was observed in the presence of 0, 1, or 2 minor alleles for the two SNPs (32). The results from this study indicate that variation in TRMT11 expression could function as a germline predictive marker for ADT failure (32). A link between a putative TRMT11 function and ADT failure was not examined.

tRNA modification and immune responses

The role of RNA modifications (including methylation) on the immune response has been examined. The higher frequency of RNA modifications in eukaryotic versus prokaryotic/viral RNA is proposed to allow the discrimination of foreign RNA from self-RNA (33-35). In addition, pathogens can use nucleotide modifications to allow for immune evasion (35). For example, the 2′-O-methylation of viral mRNA cap structures by virus-encoded MTases leads to decreased type I interferon (IFN) production (36;37). In addition, Kariko et al. determined that the immunostimulatory potential of synthetic RNA can be negatively regulated by changes in RNA 2′-O-methylation and base methylation (e.g., m⁵C, m⁶A, m⁵U, and s²U) (34). Dendritic cells exposed to the above-mentioned modified RNAs produced less cytokines than those treated with unmodified RNA (34). Also, random incorporation of the above-mentioned modifications into in vitro transcripts of messenger RNAs prevented the stimulation of TLRs (33).

Studies have determined that tRNA is a relevant RNA species in immune recognition (35;38). Modification of tRNA at guanosine 18 (G18) has recently been identified as essential for tRNA-mediated activation of Toll-like receptor 7 (TLR7; see the records for rsq1 and rsq2 for more details about Tlr7) (35), a receptor that was previously identified as a receptor for single-stranded RNA (39). G18 is a highly conserved residue in the D loop of tRNA that interacts with a pseudouridine at position 55 to stabilize the L-shaped structure of tRNA; G18 is methylated at the 2′-O-position by the G_m18-2′-O-methyltransferase, spoU/trmH (35). Jockel et al. determined that TLR7 is the specific innate immune receptor for tRNA that is methylated at the 2′-O-position at G18 (35). G18-methylated tRNA inhibited influenza A virus-mediated IFN production, indicating that 2′-O-methylated tRNA has an immunological function (35). In addition, purified tRNA from six of nine strains of nonpathogenic, pathogenic, and probiotic strains belonging to the group of gram (+) bacteria (Lactococcus lactis and Bacillus subtilis), gram (−) bacteria (E. coli Nissle 1917, Haemophilus influenzae, Pseudomonas aeruginosa, and T. thermophilus), or the domain archaea (Methanothermobacter marburgensis) also induced IFN-α in human peripheral blood mononuclear cells (PBMCs) (35). Human PBMCs or wild-type mouse FLT3L-induced dendritic cells (DCs) exhibited a concentration-dependent production of type I IFN upon tRNA stimulation; IL-6, IL-12p40, and TNF were induced in TLR2/4 double-deficient DCs and enriched human monocytes (35). In TLR7-deficient FLT3L-DCs, IFN induction by tRNA did not occur (35). Although Kariko et al. determined that nucleoside modifications at m⁵C, m⁶A, m⁵U, s²U, or pseudouridine nucleoside modification repressed TLR7-mediated activation (34), Jockel et al. propose that it is the different types/sites of nucleoside modifications that mediate the phenotypes observed (35). A further example of this is that synthetic RNA oligonucleotides or siRNA with multiple 2′-O-methylations act as TLR7 antagonists (40;41) and can abolish TLR7-mediated immunostimulatory off-target effects (40;42). Taken together, the findings of Jokel et al. point to the 2′-O-methylation status of G18 as a determinant in TLR7 activation of inhibition (35).

A concurrent study by Gehrig et al. also examined the roles of tRNA modification (in particular, G18) on immune responses (38). This study determined that G18 is necessary and sufficient for immunosuppression in a classic tRNA macromolecule (38).  Furthermore, Gehrig et al. determined that G18 was not the singular self/non-self discriminator; G_m34 and tRNA^Lys₃ are also required modifications (38). Peripheral blood mononuclear cells stimulated with E. coli mutants lacking the G18 methyltransferase, trmH, exhibited increased stimulation, indicating that the enzyme may act as a virulence factor and that the G18 modification acts as an antagonist to TLR7-mediated responses (38). In agreement with the study by Jockel et al. (35), Gehrig et al. also determined that TLR7 stimulation in plasmacytoid dendritic cells is produced the tRNA-mediated production in IFN-α (38).

References

  1. Bujnicki, J. M. (1999) Comparison of Protein Structures Reveals Monophyletic Origin of the AdoMet-Dependent Methyltransferase Family and Mechanistic Convergence rather than Recent Differentiation of N4-Cytosine and N6-Adenine DNA Methylation. In Silico Biol. 1, 175-182.

  2. Purushothaman, S. K., Bujnicki, J. M., Grosjean, H., and Lapeyre, B. (2005) Trm11p and Trm112p are both Required for the Formation of 2-Methylguanosine at Position 10 in Yeast tRNA. Mol Cell Biol. 25, 4359-4370.

  3. Schubert, H. L., Blumenthal, R. M., and Cheng, X. (2003) Many Paths to Methyltransfer: A Chronicle of Convergence. Trends Biochem Sci. 28, 329-335.

  4. Mouaikel, J., Bujnicki, J. M., Tazi, J., and Bordonne, R. (2003) Sequence-Structure-Function Relationships of Tgs1, the Yeast snRNA/snoRNA Cap Hypermethylase. Nucleic Acids Res. 31, 4899-4909.

  5. Bujnicki, J. M. (2000) Phylogenomic Analysis of 16S rRNA:(Guanine-N2) Methyltransferases Suggests New Family Members and Reveals Highly Conserved Motifs and a Domain Structure Similar to Other Nucleic Acid Amino-Methyltransferases. FASEB J. 14, 2365-2368.

  6. Aravind, L., and Koonin, E. V. (2001) THUMP--a Predicted RNA-Binding Domain Shared by 4-Thiouridine, Pseudouridine Synthases and RNA Methylases. Trends Biochem Sci. 26, 215-217.

  7. Gu, T., He, H., Zhang, Y., Han, Z., Hou, G., Zeng, T., Liu, Q., and Wu, Q. (2012) Trmt112 Gene Expression in Mouse Embryonic Development. Acta Histochem Cytochem. 45, 113-119.

  8. Sprinzl, M., Horn, C., Brown, M., Ioudovitch, A., and Steinberg, S. (1998) Compilation of tRNA Sequences and Sequences of tRNA Genes. Nucleic Acids Res. 26, 148-153.

  9. Limbach, P. A., Crain, P. F., and McCloskey, J. A. (1994) Summary: The Modified Nucleosides of RNA. Nucleic Acids Res. 22, 2183-2196.

  10. Hopper, A. K., and Phizicky, E. M. (2003) TRNA Transfers to the Limelight. Genes Dev. 17, 162-180.

  11. Grosjean, H., Sprinzl, M., and Steinberg, S. (1995) Posttranscriptionally Modified Nucleosides in Transfer RNA: Their Locations and Frequencies. Biochimie. 77, 139-141.

  12. Motorin, Y., and Grosjean, H. (1999) Multisite-Specific tRNA:M5C-Methyltransferase (Trm4) in Yeast Saccharomyces Cerevisiae: Identification of the Gene and Substrate Specificity of the Enzyme. RNA. 5, 1105-1118.

  13. Pintard, L., Lecointe, F., Bujnicki, J. M., Bonnerot, C., Grosjean, H., and Lapeyre, B. (2002) Trm7p Catalyses the Formation of Two 2'-O-Methylriboses in Yeast tRNA Anticodon Loop. EMBO J. 21, 1811-1820.

  14. Towns, W. L., and Begley, T. J. (2012) Transfer RNA Methytransferases and their Corresponding Modifications in Budding Yeast and Humans: Activities, Predications, and Potential Roles in Human Health. DNA Cell Biol. 31, 434-454.

  15. Anderson, J., Phan, L., Cuesta, R., Carlson, B. A., Pak, M., Asano, K., Bjork, G. R., Tamame, M., and Hinnebusch, A. G. (1998) The Essential Gcd10p-Gcd14p Nuclear Complex is Required for 1-Methyladenosine Modification and Maturation of Initiator Methionyl-tRNA. Genes Dev. 12, 3650-3662.

  16. Bjork, G. R., Jacobsson, K., Nilsson, K., Johansson, M. J., Bystrom, A. S., and Persson, O. P. (2001) A Primordial tRNA Modification Required for the Evolution of Life? EMBO J. 20, 231-239.

  17. Pintard, L., Lecointe, F., Bujnicki, J. M., Bonnerot, C., Grosjean, H., and Lapeyre, B. (2002) Trm7p Catalyses the Formation of Two 2'-O-Methylriboses in Yeast tRNA Anticodon Loop. EMBO J. 21, 1811-1820.

  18. Okada, K., Muneyoshi, Y., Endo, Y., and Hori, H. (2009) Production of Yeast (m2G10) Methyltransferase (Trm11 and Trm112 Complex) in a Wheat Germ Cell-Free Translation System. Nucleic Acids Symp Ser (Oxf). (53):303-4. doi, 303-304.

  19. Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M., Remor, M., Hofert, C., Schelder, M., Brajenovic, M., Ruffner, H., Merino, A., Klein, K., Hudak, M., Dickson, D., Rudi, T., Gnau, V., Bauch, A., Bastuck, S., Huhse, B., Leutwein, C., Heurtier, M. A., Copley, R. R., Edelmann, A., Querfurth, E., Rybin, V., Drewes, G., Raida, M., Bouwmeester, T., Bork, P., Seraphin, B., Kuster, B., Neubauer, G., and Superti-Furga, G. (2002) Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature. 415, 141-147.

  20. Kim, S. H., Sussman, J. L., Suddath, F. L., Quigley, G. J., McPherson, A., Wang, A. H., Seeman, N. C., and RICH, A. (1974) The General Structure of Transfer RNA Molecules. Proc Natl Acad Sci U S A. 71, 4970-4974.

  21. Robertus, J. D., Ladner, J. E., Finch, J. T., Rhodes, D., Brown, R. S., Clark, B. F., and Klug, A. (1974) Structure of Yeast Phenylalanine tRNA at 3 A Resolution. Nature. 250, 546-551.

  22. Kalhor, H. R., and Clarke, S. (2003) Novel Methyltransferase for Modified Uridine Residues at the Wobble Position of tRNA. Mol Cell Biol. 23, 9283-9292.

  23. Ramos, F., Dubois, E., and Pierard, A. (1988) Control of Enzyme Synthesis in the Lysine Biosynthetic Pathway of Saccharomyces Cerevisiae. Evidence for a Regulatory Role of Gene LYS14. Eur J Biochem. 171, 171-176.

  24. Ellis, S. R., Morales, M. J., Li, J. M., Hopper, A. K., and Martin, N. C. (1986) Isolation and Characterization of the TRM1 Locus, a Gene Essential for the N2,N2-Dimethylguanosine Modification of both Mitochondrial and Cytoplasmic tRNA in Saccharomyces Cerevisiae. J Biol Chem. 261, 9703-9709.

  25. Hopper, A. K., Furukawa, A. H., Pham, H. D., and Martin, N. C. (1982) Defects in Modification of Cytoplasmic and Mitochondrial Transfer RNAs are Caused by Single Nuclear Mutations. Cell. 28, 543-550.

  26. Vauti, F., Goller, T., Beine, R., Becker, L., Klopstock, T., Holter, S. M., Wurst, W., Fuchs, H., Gailus-Durner, V., de Angelis, M. H., and Arnold, H. H. (2007) The Mouse Trm1-Like Gene is Expressed in Neural Tissues and Plays a Role in Motor Coordination and Exploratory Behaviour. Gene. 389, 174-185.

  27. Kohli, M., Riska, S. M., Mahoney, D. W., Chai, H. S., Hillman, D. W., Rider, D. N., Costello, B. A., Qin, R., Lamba, J., Sahasrabudhe, D. M., and Cerhan, J. R. (2012) Germline Predictors of Androgen Deprivation Therapy Response in Advanced Prostate Cancer. Mayo Clin Proc. 87, 240-246.

  28. Kariko, K., Buckstein, M., Ni, H., and Weissman, D. (2005) Suppression of RNA Recognition by Toll-Like Receptors: The Impact of Nucleoside Modification and the Evolutionary Origin of RNA. Immunity. 23, 165-175.

  29. Jockel, S., Nees, G., Sommer, R., Zhao, Y., Cherkasov, D., Hori, H., Ehm, G., Schnare, M., Nain, M., Kaufmann, A., and Bauer, S. (2012) The 2'-O-Methylation Status of a Single Guanosine Controls Transfer RNA-Mediated Toll-Like Receptor 7 Activation Or Inhibition. J Exp Med. 209, 235-241.

  30. Daffis, S., Szretter, K. J., Schriewer, J., Li, J., Youn, S., Errett, J., Lin, T. Y., Schneller, S., Zust, R., Dong, H., Thiel, V., Sen, G. C., Fensterl, V., Klimstra, W. B., Pierson, T. C., Buller, R. M., Gale, M.,Jr, Shi, P. Y., and Diamond, M. S. (2010) 2'-O Methylation of the Viral mRNA Cap Evades Host Restriction by IFIT Family Members. Nature. 468, 452-456.

  31. Zust, R., Cervantes-Barragan, L., Habjan, M., Maier, R., Neuman, B. W., Ziebuhr, J., Szretter, K. J., Baker, S. C., Barchet, W., Diamond, M. S., Siddell, S. G., Ludewig, B., and Thiel, V. (2011) Ribose 2'-O-Methylation Provides a Molecular Signature for the Distinction of Self and Non-Self mRNA Dependent on the RNA Sensor Mda5. Nat Immunol. 12, 137-143.

  32. Hamm, S., Latz, E., Hangel, D., Muller, T., Yu, P., Golenbock, D., Sparwasser, T., Wagner, H., and Bauer, S. (2010) Alternating 2'-O-Ribose Methylation is a Universal Approach for Generating Non-Stimulatory siRNA by Acting as TLR7 Antagonist. Immunobiology. 215, 559-569.

  33. Robbins, M., Judge, A., Liang, L., McClintock, K., Yaworski, E., and MacLachlan, I. (2007) 2'-O-Methyl-Modified RNAs Act as TLR7 Antagonists. Mol Ther. 15, 1663-1669.

  34. Sioud, M., Furset, G., and Cekaite, L. (2007) Suppression of Immunostimulatory siRNA-Driven Innate Immune Activation by 2'-Modified RNAs. Biochem Biophys Res Commun. 361, 122-126.