Incidental Mutation 'R2908:Tmem18'
ID261111
Institutional Source Beutler Lab
Gene Symbol Tmem18
Ensembl Gene ENSMUSG00000043061
Gene Nametransmembrane protein 18
Synonyms
MMRRC Submission 040495-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2908 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location30584426-30591215 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 30587253 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 78 (R78*)
Ref Sequence ENSEMBL: ENSMUSP00000050729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057151]
Predicted Effect probably null
Transcript: ENSMUST00000057151
AA Change: R78*
SMART Domains Protein: ENSMUSP00000050729
Gene: ENSMUSG00000043061
AA Change: R78*

DomainStartEndE-ValueType
Pfam:TMEM18 14 133 5.7e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218826
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a male-specific increase in body weight, fat mass and lean mass whether fed standard chow or a high-fat diet, increased suseptibility to diet-induced obesity, increased energy expenditure and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A G 10: 77,313,403 probably null Het
Ap1b1 T A 11: 5,031,641 N516K probably damaging Het
Atp1a4 A G 1: 172,234,477 Y694H probably benign Het
Bhlha9 T C 11: 76,672,607 V20A probably benign Het
Ccl28 C A 13: 119,650,862 probably null Het
Cdk14 T C 5: 5,249,051 I55V probably benign Het
Cit C A 5: 115,981,676 D1246E probably benign Het
Clp1 A G 2: 84,724,144 V227A possibly damaging Het
Dhx29 T C 13: 112,927,851 V20A possibly damaging Het
Lima1 C T 15: 99,802,110 probably null Het
Lyst A G 13: 13,669,873 I1883V probably benign Het
Myh1 C T 11: 67,220,696 Q1654* probably null Het
Olfr1176 T C 2: 88,340,483 I306T probably benign Het
Pbx3 G T 2: 34,172,921 T422K probably damaging Het
Plekhg4 T C 8: 105,380,861 L1008P probably damaging Het
Rbm26 T A 14: 105,142,834 T516S probably benign Het
Slc25a40 C T 5: 8,427,505 T30I probably damaging Het
Spata31d1c A T 13: 65,033,191 I35F possibly damaging Het
Uggt2 C T 14: 119,019,507 S1105N probably benign Het
Zfp53 C A 17: 21,508,474 C256* probably null Het
Other mutations in Tmem18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Tmem18 APN 12 30588721 missense unknown
IGL00774:Tmem18 APN 12 30588721 missense unknown
IGL02748:Tmem18 APN 12 30588745 makesense probably null
R1557:Tmem18 UTSW 12 30587199 critical splice acceptor site probably null
R7053:Tmem18 UTSW 12 30584507 start codon destroyed probably null 0.85
R7199:Tmem18 UTSW 12 30588655 missense probably benign 0.03
R8322:Tmem18 UTSW 12 30588518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGTCACAGATGTGTTG -3'
(R):5'- TCTTAAGGCCTAACCCCATATG -3'

Sequencing Primer
(F):5'- ACTTGACAATTTTAGAGTCCTTACC -3'
(R):5'- GGCCTAACCCCATATGTATAGGCTG -3'
Posted On2015-01-23