Incidental Mutation 'R3903:Amd1'
ID309266
Institutional Source Beutler Lab
Gene Symbol Amd1
Ensembl Gene ENSMUSG00000075232
Gene NameS-adenosylmethionine decarboxylase 1
SynonymsAdoMetDC, SAMDC, Amd-1
MMRRC Submission 040907-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3903 (G1)
Quality Score107
Status Validated
Chromosome10
Chromosomal Location40287458-40302186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40290457 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 210 (R210H)
Ref Sequence ENSEMBL: ENSMUSP00000097528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099945] [ENSMUST00000214698]
Predicted Effect probably benign
Transcript: ENSMUST00000099945
AA Change: R210H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097528
Gene: ENSMUSG00000075232
AA Change: R210H

DomainStartEndE-ValueType
Pfam:SAM_decarbox 4 326 1.5e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213620
Predicted Effect probably benign
Transcript: ENSMUST00000214698
AA Change: R141H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216993
Meta Mutation Damage Score 0.0979 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation and embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amt C T 9: 108,297,221 R62C possibly damaging Het
Ap3m1 T C 14: 21,036,664 Y185C probably null Het
Calcrl T A 2: 84,368,642 probably benign Het
Ccdc178 C T 18: 22,023,095 V573I possibly damaging Het
Cdh6 T C 15: 13,042,575 K499R probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a1 C T 10: 76,711,341 R730H unknown Het
Cyp4f40 C A 17: 32,659,624 R47S possibly damaging Het
Eif4a2 AG A 16: 23,110,640 probably null Het
Gm595 T C X: 48,841,544 N649S possibly damaging Het
Gm8180 T A 14: 43,783,635 R39W probably null Het
Golm1 T C 13: 59,638,340 Q346R probably damaging Het
Grap T G 11: 61,660,325 probably null Het
Hormad2 A G 11: 4,427,237 probably benign Het
Hyal1 T C 9: 107,578,972 probably null Het
Kif12 A G 4: 63,167,976 V378A possibly damaging Het
Lrrk2 A T 15: 91,747,700 S1276C probably damaging Het
Lrrk2 G A 15: 91,747,701 S1276N probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1276 A T 2: 111,257,769 Y218F probably damaging Het
Olfr1356 T G 10: 78,847,298 I206L probably benign Het
Olfr898 C T 9: 38,349,658 Q186* probably null Het
Pabpc6 T C 17: 9,669,154 E156G probably benign Het
Rorb A G 19: 18,962,099 Y155H probably damaging Het
Samd9l T A 6: 3,376,830 K144* probably null Het
Scn1a A G 2: 66,318,132 I3T probably benign Het
Serpinb9 T C 13: 33,010,810 M183T possibly damaging Het
Wnk1 A G 6: 119,949,051 S1151P probably damaging Het
Xirp2 C T 2: 67,508,036 T207I probably benign Het
Zfp39 T C 11: 58,890,175 Y587C probably benign Het
Other mutations in Amd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Amd1 APN 10 40290190 nonsense probably null
IGL03303:Amd1 APN 10 40290125 missense possibly damaging 0.67
R0378:Amd1 UTSW 10 40289384 missense possibly damaging 0.88
R1413:Amd1 UTSW 10 40290408 nonsense probably null
R1529:Amd1 UTSW 10 40290505 missense probably benign 0.17
R1965:Amd1 UTSW 10 40294759 missense probably benign 0.14
R3904:Amd1 UTSW 10 40290457 missense probably benign 0.01
R5426:Amd1 UTSW 10 40290187 missense probably damaging 0.99
R7068:Amd1 UTSW 10 40290512 missense probably benign 0.21
R8070:Amd1 UTSW 10 40294230 missense probably benign 0.12
R8082:Amd1 UTSW 10 40290512 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTGATGTGAATAGTCCAATATGTTCCC -3'
(R):5'- TCTGTAACCTGTCGTTCTGAGG -3'

Sequencing Primer
(F):5'- GTCCAATATGTTCCCTTTGAGAAAAG -3'
(R):5'- ACCTGTCGTTCTGAGGTAAAAC -3'
Posted On2015-04-17