Incidental Mutation 'R5270:Rrh'
ID472463
Institutional Source Beutler Lab
Gene Symbol Rrh
Ensembl Gene ENSMUSG00000028012
Gene Nameretinal pigment epithelium derived rhodopsin homolog
SynonymsPeropsin
MMRRC Submission 042835-MU
Accession Numbers

Genbank: NM_009102.3; Ensembl: ENSMUST00000029648, ENSMUST00000078035 ,ENSMUST00000090295, ENSMUST00000171313

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5270 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location129804408-129822587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129813349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 142 (I142V)
Ref Sequence ENSEMBL: ENSMUSP00000029648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029648] [ENSMUST00000171313] [ENSMUST00000196902] [ENSMUST00000200079]
Predicted Effect probably benign
Transcript: ENSMUST00000029648
AA Change: I142V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029648
Gene: ENSMUSG00000028012
AA Change: I142V

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171313
AA Change: I100V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132360
Gene: ENSMUSG00000028012
AA Change: I100V

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 4.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196317
Predicted Effect probably benign
Transcript: ENSMUST00000196902
AA Change: I100V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143093
Gene: ENSMUSG00000028012
AA Change: I100V

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 36 309 3.5e-11 PFAM
Pfam:7tm_1 42 294 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197295
Predicted Effect probably benign
Transcript: ENSMUST00000197535
Predicted Effect probably benign
Transcript: ENSMUST00000200079
SMART Domains Protein: ENSMUSP00000143054
Gene: ENSMUSG00000028012

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Pfam:7tm_1 30 197 3.1e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. This gene belongs to the seven-exon subfamily of mammalian opsin genes that includes opsin 5 and retinal G protein coupled receptor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,294,218 V585A possibly damaging Het
Adam6a A T 12: 113,544,127 H40L possibly damaging Het
Adamts20 G A 15: 94,282,519 P1752S probably benign Het
Atpif1 A G 4: 132,533,300 F27L probably damaging Het
B230104I21Rik A G 4: 154,349,593 probably benign Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ciz1 C A 2: 32,374,499 probably null Het
Crb1 T A 1: 139,236,864 Y1174F probably damaging Het
Csf2rb2 A T 15: 78,291,982 probably null Het
Cyp3a25 A T 5: 145,981,502 M433K probably benign Het
D1Ertd622e T C 1: 97,645,995 Q115R probably damaging Het
Dock4 A G 12: 40,733,271 I735V probably benign Het
Dpp6 C T 5: 27,634,534 S349L probably damaging Het
Epg5 T A 18: 77,983,563 N1256K possibly damaging Het
Epha4 A G 1: 77,506,607 V255A probably damaging Het
Gabrb1 A T 5: 72,108,326 D155V probably damaging Het
Gm13103 A G 4: 143,851,898 M243V probably damaging Het
Gpr35 A T 1: 92,982,577 T4S probably benign Het
Hcrt T C 11: 100,761,997 T64A probably damaging Het
Henmt1 G A 3: 108,960,214 R355H probably benign Het
Hrh1 C A 6: 114,481,218 R487S possibly damaging Het
Ints2 T C 11: 86,215,795 S930G probably damaging Het
Irs2 G A 8: 11,006,678 Q585* probably null Het
Kcns1 C A 2: 164,168,329 R170L probably benign Het
Kdm3b T C 18: 34,827,414 S1351P probably damaging Het
Ly9 T C 1: 171,601,162 T297A probably damaging Het
M6pr G A 6: 122,315,089 D127N possibly damaging Het
Nit2 G A 16: 57,157,131 P179S probably damaging Het
Per1 T C 11: 69,103,598 M516T probably benign Het
Pkdrej A T 15: 85,818,327 I1136N probably damaging Het
Prdm9 G T 17: 15,553,363 T257K probably benign Het
Prkdc T C 16: 15,734,955 L2085P probably damaging Het
Rasgrf1 A C 9: 90,026,694 E1240D probably benign Het
Saal1 G T 7: 46,701,733 probably benign Het
Sdcbp2 A G 2: 151,584,892 I70V probably benign Het
Skida1 C A 2: 18,047,649 A231S probably benign Het
Smtnl2 T A 11: 72,399,917 T401S probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Spag4 G T 2: 156,065,933 probably benign Het
Tbc1d9 A G 8: 83,233,654 M179V probably benign Het
Tm9sf1 G T 14: 55,636,481 T520N probably damaging Het
Tmem163 G A 1: 127,491,552 probably benign Het
Vmn1r47 A T 6: 90,022,543 Q219L probably damaging Het
Vmn2r104 A T 17: 20,038,266 C539S probably damaging Het
Wdr17 G T 8: 54,643,186 S1024R probably benign Het
Zc3h4 A G 7: 16,434,515 T850A unknown Het
Zfa-ps A G 10: 52,543,456 noncoding transcript Het
Zfp146 G T 7: 30,162,475 N47K probably benign Het
Zfp353-ps G T 8: 42,081,535 noncoding transcript Het
Zfp607a A T 7: 27,878,305 K267* probably null Het
Other mutations in Rrh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Rrh APN 3 129822425 missense possibly damaging 0.53
IGL01368:Rrh APN 3 129808969 missense probably benign 0.02
IGL02206:Rrh APN 3 129811697 missense probably benign 0.40
IGL02577:Rrh APN 3 129815723 missense probably damaging 0.98
B6584:Rrh UTSW 3 129811742 missense probably damaging 1.00
R1822:Rrh UTSW 3 129812633 missense probably damaging 0.99
R2114:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2115:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2116:Rrh UTSW 3 129810687 missense probably damaging 1.00
R2484:Rrh UTSW 3 129822391 missense probably damaging 1.00
R2913:Rrh UTSW 3 129815609 missense probably damaging 0.99
R3236:Rrh UTSW 3 129811711 missense probably damaging 1.00
R3237:Rrh UTSW 3 129811711 missense probably damaging 1.00
R5221:Rrh UTSW 3 129815631 missense probably damaging 0.99
R7036:Rrh UTSW 3 129815693 missense possibly damaging 0.54
R7334:Rrh UTSW 3 129808982 missense probably benign 0.00
R7339:Rrh UTSW 3 129810613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACTTTAAGACAAATGCGTGTT -3'
(R):5'- TGTGTGAAAAGTATTCTAACAATGAGG -3'

Sequencing Primer
(F):5'- ACAAATGCGTGTTGAATGACTG -3'
(R):5'- CTCAGTGGGTAAAAATGCTTGC -3'
Posted On2017-04-07