Incidental Mutation 'R0712:Ubald2'
ID62792
Institutional Source Beutler Lab
Gene Symbol Ubald2
Ensembl Gene ENSMUSG00000050628
Gene NameUBA-like domain containing 2
Synonyms
MMRRC Submission 038895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0712 (G1)
Quality Score84
Status Not validated
Chromosome11
Chromosomal Location116434094-116439077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116434575 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 46 (F46S)
Ref Sequence ENSEMBL: ENSMUSP00000058894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057676]
Predicted Effect probably damaging
Transcript: ENSMUST00000057676
AA Change: F46S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058894
Gene: ENSMUSG00000050628
AA Change: F46S

DomainStartEndE-ValueType
Pfam:UBA_4 11 53 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144310
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd1 G A X: 73,730,865 V489M possibly damaging Het
Anln A T 9: 22,380,298 V78E probably benign Het
Atp2b4 T C 1: 133,730,478 K565E probably damaging Het
Cap2 T C 13: 46,615,361 probably null Het
Cdh22 A G 2: 165,170,656 Y170H probably damaging Het
Chrna5 A T 9: 55,004,363 K45I probably damaging Het
Dyx1c1 G T 9: 72,960,657 G67* probably null Het
Hdac8 T A X: 102,499,918 M67L probably benign Het
Lama1 A G 17: 67,779,042 probably null Het
Lrba T A 3: 86,297,990 Y380* probably null Het
Mastl A G 2: 23,150,993 Y106H probably damaging Het
Obscn T C 11: 59,049,445 E5210G possibly damaging Het
Olfr102 T A 17: 37,314,084 H100L probably damaging Het
Olfr984 A G 9: 40,101,430 V20A probably benign Het
Pcgf2 T C 11: 97,691,004 Y21C probably damaging Het
Penk T C 4: 4,134,257 E130G probably benign Het
Rnmt G A 18: 68,307,788 probably null Het
Stk11ip T A 1: 75,527,447 L277Q probably damaging Het
Synpo2l A G 14: 20,661,839 S238P probably damaging Het
Tex264 A C 9: 106,659,232 L242R possibly damaging Het
Zfp692 T C 11: 58,314,314 V463A probably benign Het
Other mutations in Ubald2
AlleleSourceChrCoordTypePredicted EffectPPH Score
ubiquity UTSW 11 116434617 missense probably benign 0.25
R1652:Ubald2 UTSW 11 116434352 missense probably damaging 1.00
R6216:Ubald2 UTSW 11 116434385 missense probably benign 0.44
R6477:Ubald2 UTSW 11 116434574 missense probably benign 0.02
R7063:Ubald2 UTSW 11 116434617 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATGTCGGTGAACACGGACGAG -3'
(R):5'- ATCGCAACATCCTGCTGGAAGC -3'

Sequencing Primer
(F):5'- CATGATCAACCAGTTCGTGC -3'
(R):5'- GCGCTCTTTCCTGGAAGAC -3'
Posted On2013-07-30