Mutagenetix > Incidental Mutation

Incidental Mutation 'R0774:Shox2'

76976

Institutional Source

Beutler Lab

Gene Symbol

Shox2

Ensembl Gene

ENSMUSG00000027833

Gene Name

SHOX homeobox 2

Synonyms

Og12x, Prx3, 6330543G17Rik

MMRRC Submission

038954-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0774 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66879060-66889104 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66881144 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 279 (A279T)

Ref Sequence

ENSEMBL: ENSMUSP00000029422 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029422] [ENSMUST00000162060] [ENSMUST00000162439] [ENSMUST00000195261]

AlphaFold

P70390

Predicted Effect

probably damaging
Transcript: ENSMUST00000029422
AA Change: A279T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: A279T

Domain	Start	End	E-Value	Type
low complexity region	57	90	N/A	INTRINSIC
HOX	140	202	1.8e-28	SMART
low complexity region	258	273	N/A	INTRINSIC
Pfam:OAR	310	327	3.3e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162060
AA Change: A138T

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125031
Gene: ENSMUSG00000027833
AA Change: A138T

Domain	Start	End	E-Value	Type
HOX	11	73	1.8e-28	SMART
low complexity region	117	132	N/A	INTRINSIC
Pfam:OAR	167	187	9.7e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000162098
AA Change: A187T

SMART Domains

Protein: ENSMUSP00000123838
Gene: ENSMUSG00000027833
AA Change: A187T

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
HOX	61	123	1.8e-28	SMART
low complexity region	167	182	N/A	INTRINSIC
Pfam:OAR	219	236	1e-10	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162439
AA Change: A138T

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124924
Gene: ENSMUSG00000027833
AA Change: A138T

Domain	Start	End	E-Value	Type
HOX	11	73	1.8e-28	SMART
low complexity region	117	132	N/A	INTRINSIC
Pfam:OAR	167	187	9.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195261

SMART Domains

Protein: ENSMUSP00000141625
Gene: ENSMUSG00000027833

Domain	Start	End	E-Value	Type
HOX	11	73	9e-31	SMART

Coding Region Coverage

1x: 99.6%
3x: 98.9%
10x: 96.8%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 7 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdhr2	C	T	13: 54,865,668 (GRCm39)	S222F	probably damaging	Het
Dennd2b	C	T	7: 109,141,527 (GRCm39)		probably null	Het
Leng8	T	A	7: 4,145,135 (GRCm39)	H178Q	probably damaging	Het
Prl3b1	G	A	13: 27,427,848 (GRCm39)	A53T	probably benign	Het
Psip1	CACTTACT	CACT	4: 83,378,689 (GRCm39)		probably null	Het
Sis	T	C	3: 72,859,864 (GRCm39)	Q297R	probably damaging	Het
Slc1a6	G	T	10: 78,648,658 (GRCm39)	V460L	probably benign	Het

Other mutations in Shox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Shox2	APN	3	66,888,774 (GRCm39)	missense	possibly damaging	0.49
IGL00813:Shox2	APN	3	66,882,777 (GRCm39)	missense	probably damaging	1.00
IGL01534:Shox2	APN	3	66,885,696 (GRCm39)	missense	probably benign	0.01
IGL01583:Shox2	APN	3	66,881,104 (GRCm39)	unclassified	probably benign
R0306:Shox2	UTSW	3	66,881,167 (GRCm39)	missense	probably damaging	0.98
R0374:Shox2	UTSW	3	66,881,184 (GRCm39)	missense	probably damaging	0.98
R0625:Shox2	UTSW	3	66,888,877 (GRCm39)	critical splice donor site	probably null
R1102:Shox2	UTSW	3	66,885,628 (GRCm39)	missense	probably damaging	1.00
R1192:Shox2	UTSW	3	66,881,243 (GRCm39)	nonsense	probably null
R2354:Shox2	UTSW	3	66,888,822 (GRCm39)	missense	possibly damaging	0.94
R2518:Shox2	UTSW	3	66,885,692 (GRCm39)	missense	possibly damaging	0.83
R4163:Shox2	UTSW	3	66,881,104 (GRCm39)	unclassified	probably benign
R4976:Shox2	UTSW	3	66,881,008 (GRCm39)	unclassified	probably benign
R5423:Shox2	UTSW	3	66,881,087 (GRCm39)	unclassified	probably benign
R5493:Shox2	UTSW	3	66,888,796 (GRCm39)	missense	probably damaging	1.00
R6528:Shox2	UTSW	3	66,888,618 (GRCm39)	missense	probably benign	0.00
RF020:Shox2	UTSW	3	66,881,146 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTTAGTCCCAAGGGCGGGTG -3'
(R):5'- CAATTCTCCCCATAGCCAAGCTGG -3'

Sequencing Primer
(F):5'- TTAGGAGGCTCCACCGAC -3'
(R):5'- CAAGCTGGACGCCTTTAATG -3'

Posted On

2013-10-16