Incidental Mutation 'R0900:Fam167a'
ID83857
Institutional Source Beutler Lab
Gene Symbol Fam167a
Ensembl Gene ENSMUSG00000035095
Gene Namefamily with sequence similarity 167, member A
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0900 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63436394-63465498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63452379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 42 (T42A)
Ref Sequence ENSEMBL: ENSMUSP00000113962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121288]
Predicted Effect probably damaging
Transcript: ENSMUST00000121288
AA Change: T42A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113962
Gene: ENSMUSG00000035095
AA Change: T42A

DomainStartEndE-ValueType
Pfam:DUF3259 131 215 7.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,940,624 F144I probably damaging Het
Als2cl A G 9: 110,890,428 R468G possibly damaging Het
Arsk C A 13: 76,098,457 probably benign Het
Cacna1d T C 14: 30,111,082 H912R probably damaging Het
Ccr1 A T 9: 123,964,334 V53D possibly damaging Het
Clec2d G A 6: 129,183,113 R30K probably benign Het
Col12a1 A G 9: 79,684,253 V975A possibly damaging Het
Col4a1 AGCCAGGGATGCCAGG AGCCAGG 8: 11,218,014 probably benign Het
Cul7 T C 17: 46,658,337 S907P probably benign Het
Depdc1b A T 13: 108,362,260 H159L possibly damaging Het
Dhx57 T C 17: 80,275,582 H198R probably benign Het
Dpp7 T C 2: 25,356,299 D10G probably damaging Het
Esp18 G A 17: 39,408,132 M7I possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm973 A G 1: 59,566,668 R553G probably benign Het
Ift140 T A 17: 25,035,812 I422N probably benign Het
Jag1 CTTT CTTTT 2: 137,090,882 probably null Het
Limk2 A G 11: 3,350,731 F204L probably damaging Het
Lmo7 A G 14: 101,887,188 D361G probably damaging Het
Maats1 G A 16: 38,336,402 S47L possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr589 T A 7: 103,155,313 M145L probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh18 A T 3: 49,756,803 F21Y probably benign Het
Pcna-ps2 T A 19: 9,284,123 Y249N probably damaging Het
Prkce A T 17: 86,625,458 D622V probably damaging Het
Prss47 A C 13: 65,049,394 V176G possibly damaging Het
Prss55 C T 14: 64,077,178 R181H probably benign Het
Prtg A T 9: 72,844,943 I204L probably benign Het
Pura T C 18: 36,287,667 I169T probably damaging Het
Rttn C T 18: 89,101,691 T1750I probably benign Het
Slc25a26 T A 6: 94,507,658 S60T probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem94 T A 11: 115,791,978 C614S probably benign Het
Trim12a T C 7: 104,304,262 N214S probably benign Het
Ube3c T C 5: 29,601,346 Y329H probably benign Het
Ubxn2a T C 12: 4,902,257 K2E probably damaging Het
Unc80 A T 1: 66,671,598 E2675D probably benign Het
Usf3 C T 16: 44,215,958 P267L probably benign Het
Vmn1r129 A T 7: 21,360,710 Y194* probably null Het
Zfp750 T C 11: 121,512,981 E356G probably benign Het
Other mutations in Fam167a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Fam167a APN 14 63462455 missense probably damaging 1.00
IGL02141:Fam167a APN 14 63452259 missense probably benign 0.27
IGL02212:Fam167a APN 14 63462629 missense probably damaging 1.00
IGL02642:Fam167a APN 14 63452272 missense probably damaging 1.00
R4183:Fam167a UTSW 14 63452320 missense probably benign
R5234:Fam167a UTSW 14 63452338 missense probably damaging 1.00
R8057:Fam167a UTSW 14 63452320 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGACCTTGCTACCCAGTAAACCTCC -3'
(R):5'- TCTCCCCTTCACCTAACAGGAAGTC -3'

Sequencing Primer
(F):5'- TAAACCTCCCGAGCGGC -3'
(R):5'- GCACATACATGGGCCTCTTG -3'
Posted On2013-11-08