Phenotypic Mutation 'vonnegut'

• Allele: vonnegut
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 48,720,032 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Gimap1
• Gene Name: GTPase, IMAP family member 1
• Synonym(s): 38kDa, Imap38, IAP38, imap
• Chromosomal Location: 48,715,988-48,720,729 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. Sequence analysis identified two alternatively spliced variants that encode the same protein. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a null allele have defects in the development of mature B and T lymphocytes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glycine changed to Tryptophan
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000062108] [ENSMUSP00000118345] [ENSMUSP00000145479]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000062108; Gene: ENSMUSG00000090019; AA Change: G215W

Domain	Start	End	E-Value	Type
Pfam:AIG1	27	239	3.8e-81	PFAM
transmembrane domain	274	291	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
  (Using ENSMUST00000054368)
• SMART Domains: Protein: ENSMUSP00000118345; Gene: ENSMUSG00000090019

Domain	Start	End	E-Value	Type
Pfam:AIG1	27	74	1.2e-19	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000145479; Gene: ENSMUSG00000090019; AA Change: G215W

Domain	Start	End	E-Value	Type
Pfam:AIG1	27	239	3.8e-81	PFAM
transmembrane domain	274	291	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000204168)
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably nonessential (E-score: 0.089)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Last Updated: 2018-12-12 2:55 PM by Anne Murray
• Record Created: 2017-08-28 7:59 AM by Bruce Beutler
• Record Posted: 2018-11-05
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Xue Zhong, Jin Huk Choi, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_008376, NM_175860; MGI:109368

Alleles Listed at MGI

All Mutations and Alleles(2) : Targeted(2)

Phenotypic Description

Figure 1. Vonnegut mice exhibit increased CD4 to CD8 T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Vonnegut mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Vonnegut mice exhibit decreased percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Vonnegut mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Vonnegut mice exhibit decreased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Vonnegut mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Vonnegut mice exhibit decreased frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Vonnegut mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Vonnegut mice exhibit decreased expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Vonnegut mice exhibit increased expression of IgM on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The vonnegut phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R5177, some of which showed an increase in the CD4 to CD8 T cell ratio (Figure 1) as well as reduced frequencies of B cells (Figure 2), IgD+ B cells (Figure 3), IgM+ B cells (Figure 4), B1 cells (Figure 5), CD8+ T cells (Figure 6), and CD8+ T cells in CD3+ T cells (Figure 7) with concomitant increased frequencies of CD4+ T cells in CD3+ T cells (Figure 8), all in the peripheral blood. IgD expression on peripheral blood B cells was reduced (Figure 9), while IgM expression on peripheral blood B cells was increased (Figure 10).

Nature of Mutation

Figure 11. Linkage mapping of the reduced CD8+ T cells in CD3+ T cells frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R5177. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 6: Zfp783 and Gimap1. The mutation in Gimap1 was presumed causative, and is a G to T transversion at base pair 48,743,098 (v38) on chromosome 6, or base pair 4,052 in the GenBank genomic region NC_000072 encoding Gimap1. The strongest association was found with a recessive model of inheritance to the reduced frequency of CD8+ T cells in CD3+ T cells, wherein three variant homozygotes departed phenotypically from five homozygous reference mice and 11 heterozygous mice with a P value of 6.379 x 10^-14 (Figure 11). 

The mutation corresponds to residue 808 in the mRNA sequence NM_008376 within exon 3 of 3 total exons.

793 TTGGTGAGGGAGCACGGGGGCGCGCACTACTCC 210 -L--V--R--E--H--G--G--A--H--Y--S-

The mutated nucleotide is indicated in red. The mutation results in a glycine to tryptophan substitution at position 215 (G215W) in the GIMAP1 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.997).

Protein Prediction

Figure 12. Domain organization of GIMAP1. GTPase motifs are indicated as G1-G5. The vonnegut mutation results in a glycine to tryptophan substitution at position 215 in the GIMAP1 protein. Abbreviations: CC, coiled-coil; TM, transmembrane domain.

Gimap1 encodes GTPase of the immunity-associated protein-1 (GIMAP1; alternatively, IMAP1, immuno-associated nucleotide [IAN]-2, IAP38, or IMAP), a member of the GIMAP (alternatively, IAN) family of GTPases. There are eight (or nine) members of the GIMAP family in mammals; see the record sphinx for more information about another GIMAP protein, Gimap5 (1).

GIMAP1 has an N-terminal RK endoplasmic reticulum (ER) retention signal, five conserved GTPase motifs (G1 to G5), and a putative C-terminal transmembrane region (Figure 12) (2). The G1 to G5 domains are within an AIG1 domain, which also contains a conserved box (consensus sequence LSxPGPHALLLVxQLGR Y/F TxE D/E) between G3 and G4; the conserved box is characteristic of all AIG1 domain GTPases (1). An IAN motif (consensus sequence RxxxFNN K/R AxxxE) partially overlaps with G5 (3). The G1 to G5 motifs function in GDP binding and exhibit GTPase activity. GIMAPs also contain putative coiled coils, which facilitate protein-protein interactions.

The vonnegut mutation results in a glycine to tryptophan substitution at position 215 (G215W) in the GIMAP1 protein; Gly215 is in the cytoplasmic region of the protein between the AIG1 domain and the transmembrane domain, putatively in the first coiled-coiled domain.

Expression/Localization

GIMAP1 is predominantly expressed in the spleen and lymph nodes (2). GIMAP1 is also expressed in the brain, heart, lungs, and kidney (4). GIMAP1 is expressed at all stages of thymopoiesis and its expression is maintained at a high level in mature lymphocytes and germinal center B cells (4-6).

GIMAP1 is downregulated by IL-4 during T helper (Th) 2 differentiation and is  upregulated by IL-12 and other Th1 differentiation-inducing cytokines in cells induced to differentiate toward the Th1 lineage (7).

GIMAP1 is localized in the endoplasmic reticulum and at the plasma membrane (8).

Background

Figure 13. Signaling pathways that regulate lymphocyte apoptosis and GIMAP family member involvement. In response to extracellular signals mediated by cell surface receptors including the TCR and cytokine receptors, Bcl-2 homology 3 (BH3) domain-only subfamily members, such as Bim or Bad, initiate apoptosis signals by binding to and inactivating anti-apoptotic Bcl-2 family members such as Bcl-2 or Bcl-xL. The inactivation of anti-apoptotic Bcl-2 family members activates the pro-apoptotic members Bax and Bak, inducing the release of cytochrome c from mitochondria into the cytosol and the subsequent activation of caspase-3 and caspase-7. These effector caspases cleave substrate proteins to execute cell death. In the intrinsic apoptosis pathway downstream of CD95/CD95L, caspase-8 mediates the cleavage of the pro-apoptotic Bcl-2 family member Bid to tBid and tBid translocates to the outer mitochondrial membrane (OMM) to activate Bcl-2 family members Bak and Bax. Bak oligomerizes, forming pores in the OMM that allow for the release of pro-apoptotic proteins such as cytochrome c and SMAC/DIABLO from the intermembrane space to the cytoplasm. Binding of cytochrome c and cytosolic ATP to apoptosis promoting factor-1 (Apaf-1) results in the formation of the apoptosome, a complex of cytochrome c, Apaf-1, and procaspase-9. The apoptosome activates caspase-9 which will then cleave caspase-3 and caspase-7. For more information about CD95/CD95L-associated apoptosis, see the record riogrande. GIMAP3 and GIMAP5 regulate mitochondrial apoptosis signals by putatively interacting with anti-apoptotic Bcl-2-family members and pro-apoptotic Bcl-2-family members, subsequently inhibiting Bcl-2 family-mediated mitochondrial signals for apoptosis and supporting T-cell survival and development. GIMAP4 might interact selectively with Bax to accelerate apoptosis induction. The precise function of GIMAP1 is unknown. Figure and legend adapted from Nitta & Takahama (2007). Other mutations found in the pathway are noted in red. This image is interactive. Click on each mutation for more information.

GTPases integrate receptor-mediated signals through binding to effectors and regulators of the actin cytoskeleton. GTPases affect multiple cellular activities, including cell morphology, polarity, migration, proliferation, apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, and transcription. The members of the mouse GIMAP family regulate the survival of immune cells through interactions with apoptotic regulatory proteins (e.g., Bcl-2) (Figure 13). GIMAP1 is required for the development and survival of mature B and T cells (5;6;9-12).

Several members of the GIMAP family are associated with autoimmune diseases, including systemic lupus erythematosus (13), Behçet’s disease (14), and type I diabetes (15). Deregulated expression of the GIMAPs have also been observed in lymphomas (6). GIMAP1 is overexpressed in diffuse large B-cell lymphomas due to hypomethylation at the Gimap locus (16). 

Gimap1-deficient mice rarely survive past postnatal day 10 (9). Conditional knockout of Gimap1 in lymphoid progenitors resulted in a loss of mature T and B cells (i.e., B1a, B1b, B2, follicular B cells, and marginal zone B cells); immature B and T cell survival was not changed (5). The T cell deficit is putatively due to a late‐stage intrathymic defect that produced T cells incapable of surviving in the periphery. Alternatively, the mature CD4⁺ and CD8⁺ T cells are dependent on GIMAP1 for their long‐term survival (5). Tamoxifen-inducible knockout of Gimap1 in mature T cells caused reduced survival of CD4⁺ and CD8⁺ T cells (9). The cell death observed in the GIMAP1‐deficient CD4⁺ T cells was preceded by loss of mitochondrial function and activation of the extrinsic apoptotic pathway (9). Mice with conditional knockout of GIMAP1 in resting and activated peripheral B cells had normal numbers of pro, pre, and immature B cells; however, the number of mature peripheral B cells as well as T2 and T3 transitional B cells were reduced (6). Mice with conditional knockout of GIMAP1 in germinal center B cells showed aberrant T-dependent antibody responses to NP-KLH (6).

Putative Mechanism

The precise function of GIMAP1 in promoting cell survival is unknown. GIMAP1 putatively functions in one of two different cellular processes to mediate cell survival: (i) protection from an endogenous mediator or process that is potentially cytotoxic/proapoptotic but normally present at subthreshold levels, or (ii) constitutive survival signaling possibly through NF-κB signaling regulation (5).

The phenotype of the vonnegut mice mimics that of Gimap1-deficient mice, indicating loss of GIMAP1-associated function in the vonnegut mice.

Primers

PCR Primer
vonnegut_pcr_F: ACTCCCTGCAGGATTATGTGC
vonnegut_pcr_R: CCCTTTCTGTAGAACAGCAGG

Sequencing Primer
vonnegut_seq_F: CCTGCAGGATTATGTGCACTGC
vonnegut_seq_R: CCTTTCTGTAGAACAGCAGGTAGATC

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

PCR Primers

vonnegut_PCR_F: 5’- ACTCCCTGCAGGATTATGTGC-3’

vonnegut_PCR_R: 5’- CCCTTTCTGTAGAACAGCAGG-3’

Sequencing Primers

vonnegut_SEQ_F: 5’- CCTGCAGGATTATGTGCACTGC-3’
 

vonnegut_SEQ_R: 5’- CCTTTCTGTAGAACAGCAGGTAGATC-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 403 nucleotides is amplified:

actccctgca ggattatgtg cactgcacgg acaaccgcgc gctgcgggac ctggtggccg

agtgcggggg ccgcgtgtgc gccctcaaca accgcgccac aggcagcgag cgcgaggctc

aggctgagca gctgctgggc atggttgcgt gcttggtgag ggagcacggg ggcgcgcact

actccaatga ggtgtatgag ctggtgcagg acacgcggtg cgctgacccc caggaccaag

tagccaaggt ggcagagata gtggctgagc gcatgcagag gcgcaccagg ttgctagctg

ggctgtgggg atggcggaaa ttctactgga agggctggag gcgtggtttc tctgtcttcc

tgggtgtggc catcttgatc tacctgctgt tctacagaaa ggg

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = G>T).

References

  1. Krucken, J., Schroetel, R. M., Muller, I. U., Saidani, N., Marinovski, P., Benten, W. P., Stamm, O., and Wunderlich, F. (2004) Comparative Analysis of the Human Gimap Gene Cluster Encoding a Novel GTPase Family. Gene. 341, 291-304.

  2. Stamm, O., Krucken, J., Schmitt-Wrede, H. P., Benten, W. P., and Wunderlich, F. (2002) Human Ortholog to Mouse Gene imap38 Encoding an ER-Localizable G-Protein Belongs to a Gene Family Clustered on Chromosome 7q32-36. Gene. 282, 159-167.

  3. Nitta, T., Nasreen, M., Seike, T., Goji, A., Ohigashi, I., Miyazaki, T., Ohta, T., Kanno, M., and Takahama, Y. (2006) IAN Family Critically Regulates Survival and Development of T Lymphocytes. PLoS Biol. 4, e103.

  4. Saunders, A., Lamb, T., Pascall, J., Hutchings, A., Dion, C., Carter, C., Hepburn, L., Langhorne, J., and Butcher, G. W. (2009) Expression of GIMAP1, a GTPase of the Immunity-Associated Protein Family, is Not Up-Regulated in Malaria. Malar J. 8, 53-2875-8-53.

  5. Saunders, A., Webb, L. M., Janas, M. L., Hutchings, A., Pascall, J., Carter, C., Pugh, N., Morgan, G., Turner, M., and Butcher, G. W. (2010) Putative GTPase GIMAP1 is Critical for the Development of Mature B and T Lymphocytes. Blood. 115, 3249-3257.

  6. Webb, L. M., Datta, P., Bell, S. E., Kitamura, D., Turner, M., and Butcher, G. W. (2016) GIMAP1 is Essential for the Survival of Naive and Activated B Cells in Vivo. J Immunol. 196, 207-216.

  7. Filen, J. J., Filen, S., Moulder, R., Tuomela, S., Ahlfors, H., West, A., Kouvonen, P., Kantola, S., Bjorkman, M., Katajamaa, M., Rasool, O., Nyman, T. A., and Lahesmaa, R. (2009) Quantitative Proteomics Reveals GIMAP Family Proteins 1 and 4 to be Differentially Regulated during Human T Helper Cell Differentiation. Mol Cell Proteomics. 8, 32-44.

  8. Stamm, O., Krucken, J., Schmitt-Wrede, H. P., Benten, W. P., and Wunderlich, F. (2002) Human Ortholog to Mouse Gene imap38 Encoding an ER-Localizable G-Protein Belongs to a Gene Family Clustered on Chromosome 7q32-36. Gene. 282, 159-167.

  9. Datta, P., Webb, L. M., Avdo, I., Pascall, J., and Butcher, G. W. (2017) Survival of Mature T Cells in the Periphery is Intrinsically Dependent on GIMAP1 in Mice. Eur J Immunol. 47, 84-93.

  10. Chen, Y., Yu, M., Dai, X., Zogg, M., Wen, R., Weiler, H., and Wang, D. (2011) Critical Role for Gimap5 in the Survival of Mouse Hematopoietic Stem and Progenitor Cells. J Exp Med. 208, 923-935.

  11. Filen, S., and Lahesmaa, R. (2010) GIMAP Proteins in T-Lymphocytes. J Signal Transduct. 2010, 268589.

  12. Yano, K., Carter, C., Yoshida, N., Abe, T., Yamada, A., Nitta, T., Ishimaru, N., Takada, K., Butcher, G. W., and Takahama, Y. (2014) Gimap3 and Gimap5 Cooperate to Maintain T-Cell Numbers in the Mouse. Eur J Immunol. 44, 561-572.

  13. Hellquist, A., Zucchelli, M., Kivinen, K., Saarialho-Kere, U., Koskenmies, S., Widen, E., Julkunen, H., Wong, A., Karjalainen-Lindsberg, M. L., Skoog, T., Vendelin, J., Cunninghame-Graham, D. S., Vyse, T. J., Kere, J., and Lindgren, C. M. (2007) The Human GIMAP5 Gene has a Common Polyadenylation Polymorphism Increasing Risk to Systemic Lupus Erythematosus. J Med Genet. 44, 314-321.

  14. Lee, Y. J., Horie, Y., Wallace, G. R., Choi, Y. S., Park, J. A., Choi, J. Y., Song, R., Kang, Y. M., Kang, S. W., Baek, H. J., Kitaichi, N., Meguro, A., Mizuki, N., Namba, K., Ishida, S., Kim, J., Niemczyk, E., Lee, E. Y., Song, Y. W., Ohno, S., and Lee, E. B. (2013) Genome-Wide Association Study Identifies GIMAP as a Novel Susceptibility Locus for Behcet's Disease. Ann Rheum Dis. 72, 1510-1516.

  15. Heinonen, M. T., Laine, A. P., Soderhall, C., Gruzieva, O., Rautio, S., Melen, E., Pershagen, G., Lahdesmaki, H. J., Knip, M., Ilonen, J., Henttinen, T. A., Kere, J., Lahesmaa, R., and Finnish Pediatric Diabetes Registry. (2015) GIMAP GTPase Family Genes: Potential Modifiers in Autoimmune Diabetes, Asthma, and Allergy. J Immunol. 194, 5885-5894.

  16. Chambwe, N., Kormaksson, M., Geng, H., De, S., Michor, F., Johnson, N. A., Morin, R. D., Scott, D. W., Godley, L. A., Gascoyne, R. D., Melnick, A., Campagne, F., and Shaknovich, R. (2014) Variability in DNA Methylation Defines Novel Epigenetic Subgroups of DLBCL Associated with Different Clinical Outcomes. Blood. 123, 1699-1708.