Phenotypic Mutation 'johan'

• Allele: johan
• Mutation Type: missense
• Chromosome: 6
• Coordinate: 113,750,349 bp (GRCm39)
• Base Change: C ⇒ T (forward strand)
• Gene: Atp2b2
• Gene Name: ATPase, Ca++ transporting, plasma membrane 2
• Synonym(s): PMCA2, Gena300, wms, D6Abb2e, jog, Tmy
• Chromosomal Location: 113,720,803-114,019,574 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Arginine changed to Histidine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000086398] [ENSMUSP00000098605] [ENSMUSP00000098606] [ENSMUSP00000138165] [ENSMUSP00000145174]
• AlphaFold: Q9R0K7
• SMART Domains: Protein: ENSMUSP00000086398; Gene: ENSMUSG00000030302; AA Change: R625H

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	1.7e-56	PFAM
Pfam:Hydrolase	448	787	3.9e-25	PFAM
Pfam:HAD	451	784	2.4e-16	PFAM
Pfam:Hydrolase_like2	497	593	9.4e-17	PFAM
Pfam:Hydrolase_3	745	820	1.7e-6	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	7.3e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1144	1.4e-31	PFAM
low complexity region	1151	1166	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000089003)
• SMART Domains: Protein: ENSMUSP00000098605; Gene: ENSMUSG00000030302; AA Change: R670H

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	155	307	4.2e-28	PFAM
low complexity region	313	330	N/A	INTRINSIC
low complexity region	337	356	N/A	INTRINSIC
Pfam:E1-E2_ATPase	373	488	1.4e-13	PFAM
Pfam:Hydrolase	493	832	8.1e-16	PFAM
Pfam:HAD	496	829	6.3e-21	PFAM
Pfam:Cation_ATPase	542	638	4.4e-17	PFAM
Pfam:Hydrolase_3	791	865	8.3e-7	PFAM
transmembrane domain	878	900	N/A	INTRINSIC
Pfam:Cation_ATPase_C	902	1084	2.5e-47	PFAM
low complexity region	1102	1115	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1126	1178	2.4e-30	PFAM
low complexity region	1196	1211	N/A	INTRINSIC
low complexity region	1220	1234	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000101044)
• SMART Domains: Protein: ENSMUSP00000098606; Gene: ENSMUSG00000030302; AA Change: R625H

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	1.7e-56	PFAM
Pfam:Hydrolase	448	787	3.9e-25	PFAM
Pfam:HAD	451	784	2.4e-16	PFAM
Pfam:Hydrolase_like2	497	593	9.4e-17	PFAM
Pfam:Hydrolase_3	745	820	1.7e-6	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	7.3e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1144	1.4e-31	PFAM
low complexity region	1151	1166	N/A	INTRINSIC
low complexity region	1175	1189	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000101045)
• SMART Domains: Protein: ENSMUSP00000138165; Gene: ENSMUSG00000030302; AA Change: R625H

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	156	444	6.1e-57	PFAM
Pfam:Hydrolase	448	787	1.4e-25	PFAM
Pfam:HAD	451	784	7.7e-17	PFAM
Pfam:Hydrolase_like2	497	593	4.4e-17	PFAM
Pfam:Hydrolase_3	745	820	4.2e-7	PFAM
transmembrane domain	833	855	N/A	INTRINSIC
Pfam:Cation_ATPase_C	857	1039	2.7e-46	PFAM
low complexity region	1057	1070	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1081	1149	1.3e-19	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000152831)
• SMART Domains: Protein: ENSMUSP00000145174; Gene: ENSMUSG00000030302; AA Change: R625H

Domain	Start	End	E-Value	Type
Cation_ATPase_N	47	123	1.21e-4	SMART
Pfam:E1-E2_ATPase	155	310	1.9e-28	PFAM
Pfam:E1-E2_ATPase	328	443	1.1e-13	PFAM
Pfam:HAD	451	780	2.7e-19	PFAM
Pfam:Cation_ATPase	497	593	5.8e-17	PFAM
Pfam:Hydrolase	576	783	2e-8	PFAM
Pfam:Hydrolase_3	711	816	2.3e-7	PFAM
transmembrane domain	829	851	N/A	INTRINSIC
Pfam:Cation_ATPase_C	853	1035	2.5e-47	PFAM
low complexity region	1053	1066	N/A	INTRINSIC
Pfam:ATP_Ca_trans_C	1077	1129	2.6e-30	PFAM
low complexity region	1147	1162	N/A	INTRINSIC
low complexity region	1171	1185	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000205052)
• Meta Mutation Damage Score: 0.8968
• Is this an essential gene?: Probably essential (E-score: 0.889)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:31 PM by Anne Murray
• Record Created: 2019-01-15 8:10 PM by Bruce Beutler
• Record Posted: 2019-01-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_009723, NM_001036684, NM_001347365; MGI:105368

Alleles Listed at MGI

All Mutations and Alleles(20) : Chemically induced (ENU)(7) Gene trapped(2) Spontaneous(8) Targeted(3)

Phenotypic Description

Figure 1. Johan mice exhibited reduced body weights compared to wild-type littermates. Scaled weights of the males of the pedigree are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The johan phenotype was identified among G3 mice of the pedigree R0791, in which some males of the pedigree showed reduced body weights compared to wild-type male littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 59 mutations (X-axis) identified in the G1 male of pedigree R0791. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 59 mutations. The body weight phenotype was linked to a mutation in Atp2b2: a G to A transition at base pair 113,773,388 (v38) on chromosome 6, or base pair 269,226 in the GenBank genomic region NC_000072. The strongest association was found with a recessive model of inheritance to the normalized B:T ratio, wherein six variant homozygotes departed phenotypically from 10 homozygous reference mice and 11 heterozygous mice with a P value of 2.49 x 10^-13 (Figure 2).  

The mutation corresponds to residue 2,502 in the mRNA sequence NM_009723 (variant 1) within exon 13 of 22 total exons.

2486 GCCTGTGACGGGCTCCGTACCATCTGCGTGGCC 620  -A--C--D--G--L--R--T--I--C--V--A-

The mutated nucleotide is indicated in red. The mutation results in an arginine to histidine substitution at position 625 (R625H) in the plasma membrane calcium (Ca²⁺)-ATPase, type 2 (PMCA2) protein (isoform 1), and is strongly predicted by PolyPhen-2 to cause loss of function (score = 1.000).

Protein Prediction

Figure 3. Topology and domain structure of PMCA2. The protein product of the w/a Atp2b2 transcript is shown. The transmembrane domains are indicated as well as the calmodulin (CaM)-binding site, and the A, P, N, and M regions. PMCA2 undergoes alternative splicing at two sites (within cytoplasmic loops between transmembrane domains 2 and 3 (A site) and within the CaM-binding domain (site C) potentially altering two regions of the protein. The mutation in johan results in an arginine to histidine substitution at position 625 (R625H). For more details about the transcripts generated by Atp2b2 alternative splicing, see the text and Table 1 on the lohan page.

PMCA2 is a member of the P-type superfamily of ATPases, a large group of evolutionarily related ion pumps that use the free energy of ATP hydrolysis to drive transport and establish ion gradients across membranes (1). In all P-type ATPases both the N- and C-termini are located on the cytoplasmic side of the membrane; the proteins contain an even number of transmembrane domains [Figure 3; (2;3); PDB:1SU4]. Four well-defined, conserved protein domains exist in P-type ATPases: the phosphorylation (P) domain, nucleotide-binding (N) domain, actuator (A) domain, and membrane (M) domain (3).  The P, N, and A domains are positioned cytoplasmically, whereas the M domain spans the plasma membrane.  The P domain is the catalytic core of P-type ATPases, containing a conserved sequence (DKTGTLT) in which the aspartate residue is reversibly autophosphorylated to form the high energy E1-P intermediate of the reaction cycle (4). The P domain is flanked by TM4 and TM5 and assembles into a seven-stranded parallel β-strand and eight short α-helices, forming a Rossmann fold (3). The P domain in PMCA2 comprises the catalytic region and includes the ATP binding site and the aspartate residue that forms the acyl phosphate during ATP hydrolysis. The N domain is linked to the P domain by a conserved hinge of two antiparallel strands, and serves to bind Mg²⁺-ATP and deliver it to the phosphorylation site in the P domain. The N domain contains the ATP-binding pocket and is inserted in the P domain (3). The N domain is comprised of a seven-stranded antiparallel β-strand surrounded by two helix bundles (3). The A domain comprises the domain between TM2 and TM3 and is comprised of two short helices (3). The A domain in PMCA2 comprises the transduction domain, which is proposed to mediate long-range transmissions of conformational changes that occur during the transport cycle. The M domain consists of ten membrane-spanning helices that surround the ion-binding sites, and is directly linked to the P domain through helices M4 and M5. 

The C-terminal tail of PMCA2 interacts with two sites within the first and second cytosolic loops to prevent high-affinity Ca²⁺ binding and transport while the levels of intracellular are Ca²⁺ low (5). The C-terminal tail also contains a calmodulin (CaM)-binding domain, protein kinase A (PKA) and PKC phosphorylation sites, and sites for protein-protein interactions that mediate PMCA2 membrane localization, targeting, and signaling cross-talk (5). Binding of CaM to PMCA2 is inhibitory, maintaining PMCA2 in an inactive state in the presence of low intracellular free Ca²⁺ (5).

Atp2b2 undergoes alternative splicing to generate several variants (Figure 3). Splicing affects site A within the first cytosolic loop between TM2 and TM3 as well as site C in the CaM-binding domain. For more information about the PMCA2 variants, see the record for lohan.

The johan mutation results in an arginine to histidine substitution at position 625 (R625H). Arg625 is in proximity to the N and P regions.

Please see the record lohan for more information about Atp2b2.

Putative Mechanism

The Na⁺/Ca²⁺ exchanger, ATP-dependent transporters, including PMCA2, function in the regulation of Ca²⁺ homeostasis in the cell by mediating Ca²⁺ influx in the cytosol. PMCA2 has several known functions. (i) PMCA2 regulates Ca²⁺ transport back to the endolymph in the inner ear, which increases the rate and extent of adaptation (6). (ii) PMCA2 is essential for the regulation of Ca²⁺ equilibrium in dendrites and the subsequent control of dendritic growth (7). (iii) PMCA2 is also required for the electrical excitability of Purkinje neurons (8;9). (iv) PMCA2 transports calcium across the apical surface of mammary epithelial cells (MECs) into milk (10;11).

Several Atp2b2 mutant mouse models have been characterized including Atp2b2^-/- mouse models (12;13), several spontaneous mutants [wriggle mouse Sagami (wri) (14-17), deafwaddler (dfw), dfw^2J, dfw^3J, and dfwⁱ⁵ (18-21)], and several ENU-induced mutants [Atp2b2^{Deaf11/Deaf11} (22), Atp2b2^{Deaf13/Deaf13} (22), Atp2b2^Elfin/Elfin (23), Atp2b2^Obv/Obv (24), and Atp2b2^Tmy/Tmy (25)]. Homozygotes of all models exhibit variable degeneration of the organ of Corti resulting in complete deafness and vestibular defects including unsteady gaits, disturbed balance, head bobbing, reduced body weights/sizes, and ataxia (12;14;18-20;23-25). Atp2b2^-/- and the ENU-induced mutant mice exhibited loss of the otoconia, crystals of calcium carbonate in the saccule and utricle of the ear important for the detection of linear acceleration and head position with respect to gravity (23-25). Heterozygous mice also exhibit variable hearing impairment, but do not have vestibular defects (13).

The reduced body weight phenotype observed in the johan mice indicates loss of some PMCA2-associated function. Vestibular defects were not noted in the johan mice, indicating that some PMCA2 function may be retained.

Primers

PCR Primer
johan_pcr_F: GTTACACGGGGACCTGAAACTGAG
johan_pcr_R: TGTAAAGCCCACCTGGTTGCAC

Sequencing Primer
johan_seq_F: CCTGAAACTGAGAGAGCTGAGC
johan_seq_R: GCCTGCTACATGCATTGAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 440 nucleotides is amplified (chromosome 6, - strand):

1   tgtaaagccc acctggttgc actccaggcc tgctacatgc attgaggtat tctgggaagc
61  agatccggtg ggcatttgat gaccaaggta ggtgggcttc attcatttcc tttccttccc
121 accccaggtg ctgcaagatc ctcagtgggg caggggaagc ccgtgtcttc cggccccgag
181 acagggatga gatggttaag aaggtgattg agcccatggc ctgtgacggg ctccgtacca
241 tctgcgtggc ctatcgtgac ttccccagca gccctgagcc tgactgggac aatgagaatg
301 acattctcaa tgaactcacg tgcatctgcg tggtgggcat cgaagaccca gtacgacctg
361 aggtaggccc tgatgccagc gagctcaggg aaaggggact ctgtctgctc agctctctca
421 gtttcaggtc cccgtgtaac 

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Kuhlbrandt, W. (2004) Biology, Structure and Mechanism of P-Type ATPases. Nat Rev Mol Cell Biol. 5, 282-295.

  2. Monteith, G. R., Wanigasekara, Y., and Roufogalis, B. D. (1998) The Plasma Membrane Calcium Pump, its Role and Regulation: New Complexities and Possibilities. J Pharmacol Toxicol Methods. 40, 183-190.

  3. Toyoshima, C., Nakasako, M., Nomura, H., and Ogawa, H. (2000) Crystal Structure of the Calcium Pump of Sarcoplasmic Reticulum at 2.6 A Resolution. Nature. 405, 647-655.

  4. Post, R. L., and Kume, S. (1973) Evidence for an Aspartyl Phosphate Residue at the Active Site of Sodium and Potassium Ion Transport Adenosine Triphosphatase. J Biol Chem. 248, 6993-7000.

  5. Carafoli, E. (1992) The Ca2+ Pump of the Plasma Membrane. J Biol Chem. 267, 2115-2118.

  6. Wood, J. D., Muchinsky, S. J., Filoteo, A. G., Penniston, J. T., and Tempel, B. L. (2004) Low Endolymph Calcium Concentrations in deafwaddler2J Mice Suggest that PMCA2 Contributes to Endolymph Calcium Maintenance. J Assoc Res Otolaryngol. 5, 99-110.

  7. Sherkhane, P., and Kapfhammer, J. P. (2013) The Plasma Membrane Ca2+-ATPase2 (PMCA2) is Involved in the Regulation of Purkinje Cell Dendritic Growth in Cerebellar Organotypic Slice Cultures. Neural Plast. 2013, 321685.

  8. Empson, R. M., Akemann, W., and Knopfel, T. (2010) The Role of the Calcium Transporter Protein Plasma Membrane Calcium ATPase PMCA2 in Cerebellar Purkinje Neuron Function. Funct Neurol. 25, 153-158.

  9. Empson, R. M., Garside, M. L., and Knopfel, T. (2007) Plasma Membrane Ca2+ ATPase 2 Contributes to Short-Term Synapse Plasticity at the Parallel Fiber to Purkinje Neuron Synapse. J Neurosci. 27, 3753-3758.

  10. VanHouten, J. N., Neville, M. C., and Wysolmerski, J. J. (2007) The Calcium-Sensing Receptor Regulates Plasma Membrane Calcium Adenosine Triphosphatase Isoform 2 Activity in Mammary Epithelial Cells: A Mechanism for Calcium-Regulated Calcium Transport into Milk. Endocrinology. 148, 5943-5954.

  11. Reinhardt, T. A., Lippolis, J. D., Shull, G. E., and Horst, R. L. (2004) Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2 Impairs Calcium Transport into Milk. J Biol Chem. 279, 42369-42373.

  12. Kozel, P. J., Friedman, R. A., Erway, L. C., Yamoah, E. N., Liu, L. H., Riddle, T., Duffy, J. J., Doetschman, T., Miller, M. L., Cardell, E. L., and Shull, G. E. (1998) Balance and Hearing Deficits in Mice with a Null Mutation in the Gene Encoding Plasma Membrane Ca2+-ATPase Isoform 2. J Biol Chem. 273, 18693-18696.

  13. Kozel, P. J., Davis, R. R., Krieg, E. F., Shull, G. E., and Erway, L. C. (2002) Deficiency in Plasma Membrane Calcium ATPase Isoform 2 Increases Susceptibility to Noise-Induced Hearing Loss in Mice. Hear Res. 164, 231-239.

  14. Takahashi, K., and Kitamura, K. (1999) A Point Mutation in a Plasma Membrane Ca(2+)-ATPase Gene Causes Deafness in Wriggle Mouse Sagami. Biochem Biophys Res Commun. 261, 773-778.

  15. Inoue, Y., Matsumura, Y., Inoue, K., Ichikawa, R., and Takayama, C. (1993) Abnormal Synaptic Architecture in the Cerebellar Cortex of a New Dystonic Mutant Mouse, Wriggle Mouse Sagami. Neurosci Res. 16, 39-48.

  16. Takahashi, K., Osawa, N., Ohmura, M., and Kitamura, K. (1999) Evaluation of Inner Ear Histology and Auditory Brainstem Response in Wriggle Mouse Sagami. Acta Otolaryngol. 119, 767-772.

  17. Ueno, T., Kameyama, K., Hirata, M., Ogawa, M., Hatsuse, H., Takagaki, Y., Ohmura, M., Osawa, N., and Kudo, Y. (2002) A Mouse with a Point Mutation in Plasma Membrane Ca2+-ATPase Isoform 2 Gene showed the Reduced Ca2+ Influx in Cerebellar Neurons. Neurosci Res. 42, 287-297.

  18. Street, V. A., McKee-Johnson, J. W., Fonseca, R. C., Tempel, B. L., and Noben-Trauth, K. (1998) Mutations in a Plasma Membrane Ca2+-ATPase Gene Cause Deafness in Deafwaddler Mice. Nat Genet. 19, 390-394.

  19. McCullough, B. J., and Tempel, B. L. (2004) Haplo-Insufficiency Revealed in Deafwaddler Mice when Tested for Hearing Loss and Ataxia. Hear Res. 195, 90-102.

  20. Noben-Trauth, K., Zheng, Q. Y., Johnson, K. R., and Nishina, P. M. (1997) Mdfw: A Deafness Susceptibility Locus that Interacts with Deaf Waddler (Dfw). Genomics. 44, 266-272.

  21. Watson, C. J., and Tempel, B. L. (2013) A New Atp2b2 Deafwaddler Allele, Dfw(i5), Interacts Strongly with Cdh23 and Other Auditory Modifiers. Hear Res. 304, 41-48.

  22. Carpinelli, M. R., Manning, M. G., Kile, B. T., and Burt, R. A. (2013) Two ENU-Induced Alleles of Atp2b2 Cause Deafness in Mice. PLoS One. 8, e67479.

  23. Xu, L., Wang, Z., Xiong, X., Gu, X., Gao, X., and Gao, X. (2011) Identification of a Novel Point Mutation of Mouse Atp2b2 Induced by N-Ethyl-N-Nitrosourea Mutagenesis. Exp Anim. 60, 71-78.

  24. Spiden, S. L., Bortolozzi, M., Di Leva, F., de Angelis, M. H., Fuchs, H., Lim, D., Ortolano, S., Ingham, N. J., Brini, M., Carafoli, E., Mammano, F., and Steel, K. P. (2008) The Novel Mouse Mutation Oblivion Inactivates the PMCA2 Pump and Causes Progressive Hearing Loss. PLoS Genet. 4, e1000238.

  25. Bortolozzi, M., Brini, M., Parkinson, N., Crispino, G., Scimemi, P., De Siati, R. D., Di Leva, F., Parker, A., Ortolano, S., Arslan, E., Brown, S. D., Carafoli, E., and Mammano, F. (2010) The Novel PMCA2 Pump Mutation Tommy Impairs Cytosolic Calcium Clearance in Hair Cells and Links to Deafness in Mice. J Biol Chem. 285, 37693-37703.