Incidental Mutation 'R5560:Atp2b2'
ID 436520
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene Name ATPase, Ca++ transporting, plasma membrane 2
Synonyms PMCA2, Gena300, wms, D6Abb2e, jog, Tmy
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.902) question?
Stock # R5560 (G1)
Quality Score 105
Status Not validated
Chromosome 6
Chromosomal Location 113720803-114019574 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113751319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000098605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
AlphaFold Q9R0K7
Predicted Effect probably benign
Transcript: ENSMUST00000089003
AA Change: D538G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: D538G

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101044
AA Change: D583G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: D583G

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101045
AA Change: D538G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: D538G

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152831
AA Change: D538G

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: D538G

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205052
AA Change: D538G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: D538G

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113,782,476 (GRCm39) missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113,766,932 (GRCm39) missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113,790,828 (GRCm39) missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113,770,691 (GRCm39) missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113,790,903 (GRCm39) missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113,770,815 (GRCm39) missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113,725,506 (GRCm39) missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113,736,103 (GRCm39) missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113,737,820 (GRCm39) splice site probably benign
IGL03290:Atp2b2 APN 6 113,770,715 (GRCm39) missense probably damaging 1.00
johan UTSW 6 113,750,349 (GRCm39) missense probably damaging 1.00
lohan UTSW 6 113,737,611 (GRCm39) missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113,739,813 (GRCm39) nonsense probably null
R0116:Atp2b2 UTSW 6 113,770,656 (GRCm39) missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113,770,743 (GRCm39) missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113,770,743 (GRCm39) missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113,770,743 (GRCm39) missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113,770,835 (GRCm39) missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113,790,849 (GRCm39) missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113,750,349 (GRCm39) missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113,750,349 (GRCm39) missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113,770,849 (GRCm39) splice site probably null
R1248:Atp2b2 UTSW 6 113,794,153 (GRCm39) missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113,751,162 (GRCm39) splice site probably benign
R1809:Atp2b2 UTSW 6 113,780,704 (GRCm39) intron probably benign
R1829:Atp2b2 UTSW 6 113,750,329 (GRCm39) missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113,819,244 (GRCm39) missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113,737,611 (GRCm39) missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113,773,268 (GRCm39) missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113,766,718 (GRCm39) missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113,774,069 (GRCm39) critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113,737,792 (GRCm39) missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113,770,679 (GRCm39) missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113,742,745 (GRCm39) missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113,737,672 (GRCm39) missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113,766,847 (GRCm39) missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113,819,147 (GRCm39) missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113,736,122 (GRCm39) missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113,736,193 (GRCm39) missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113,736,199 (GRCm39) missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113,819,102 (GRCm39) missense probably damaging 1.00
R5589:Atp2b2 UTSW 6 113,751,400 (GRCm39) missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113,736,270 (GRCm39) missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113,770,728 (GRCm39) missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113,790,838 (GRCm39) missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113,774,092 (GRCm39) missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113,737,681 (GRCm39) missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113,742,693 (GRCm39) missense possibly damaging 0.89
R8219:Atp2b2 UTSW 6 113,770,811 (GRCm39) missense probably damaging 1.00
R8233:Atp2b2 UTSW 6 113,742,680 (GRCm39) critical splice donor site probably null
R8286:Atp2b2 UTSW 6 113,819,275 (GRCm39) missense possibly damaging 0.64
R8369:Atp2b2 UTSW 6 113,790,747 (GRCm39) critical splice donor site probably null
R8444:Atp2b2 UTSW 6 113,770,772 (GRCm39) missense probably benign 0.18
R8942:Atp2b2 UTSW 6 113,790,991 (GRCm39) missense probably benign 0.00
R8953:Atp2b2 UTSW 6 113,737,630 (GRCm39) missense possibly damaging 0.82
R8977:Atp2b2 UTSW 6 113,750,325 (GRCm39) missense probably damaging 1.00
R9051:Atp2b2 UTSW 6 113,740,566 (GRCm39) missense probably damaging 1.00
R9399:Atp2b2 UTSW 6 113,780,713 (GRCm39) missense probably benign
R9648:Atp2b2 UTSW 6 113,780,707 (GRCm39) critical splice donor site probably null
X0020:Atp2b2 UTSW 6 113,782,461 (GRCm39) missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113,782,460 (GRCm39) missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113,819,267 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTTAGATCCAGCCTGC -3'
(R):5'- CTCGGGGTCAAAATGATAACCAG -3'

Sequencing Primer
(F):5'- TGATGTGTGATGCAGACACCC -3'
(R):5'- ATGATAACCAGGTCAGTGGCTCC -3'
Posted On 2016-10-24