Phenotypic Mutation 'spelling' (pdf version)
Allelespelling
Mutation Type missense
ChromosomeX
Coordinate60,290,036 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Atp11c
Gene Name ATPase, class VI, type 11C
Synonym(s) Ig, A330005H02Rik
Chromosomal Location 60,223,290-60,592,698 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous or hemizygous for an ENU mutation exhibit decreased B cells associated with arrested adult B cell lymphopoiesis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001001798; MGI: 1859661

Mapped Yes 
Amino Acid Change Isoleucine changed to Lysine
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000033480
Gene: ENSMUSG00000062949
AA Change: I355K

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 5.2e-18 PFAM
Pfam:Hydrolase 403 827 1.6e-12 PFAM
Pfam:HAD 406 825 9.2e-21 PFAM
Pfam:Hydrolase_like2 467 576 1.3e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000033480)
SMART Domains Protein: ENSMUSP00000099066
Gene: ENSMUSG00000062949
AA Change: I355K

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:E1-E2_ATPase 94 379 1.2e-17 PFAM
Pfam:Hydrolase 403 827 1.8e-12 PFAM
Pfam:HAD 406 825 1.4e-20 PFAM
Pfam:Hydrolase_like2 467 576 3.7e-14 PFAM
low complexity region 853 865 N/A INTRINSIC
low complexity region 994 1013 N/A INTRINSIC
low complexity region 1068 1085 N/A INTRINSIC
low complexity region 1091 1105 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000101527)
SMART Domains Protein: ENSMUSP00000119320
Gene: ENSMUSG00000062949
AA Change: I355K

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 22 91 2.6e-25 PFAM
Pfam:E1-E2_ATPase 96 371 2.7e-13 PFAM
Pfam:Hydrolase 403 725 2.4e-7 PFAM
Pfam:HAD 406 825 3.4e-19 PFAM
Pfam:Cation_ATPase 467 576 8.6e-14 PFAM
Pfam:PhoLip_ATPase_C 842 1094 3.4e-71 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000154051)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Possibly nonessential (E-score: 0.320) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
hematopoietic system
homeostasis/metabolism
liver/biliary system
reproductive system
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
18nih30a APN X 36608577 unclassified probably benign
ambrosius APN X 36608577 unclassified probably benign
IGL00578:Atp11c APN X 60240817 missense probably damaging 1.00
IGL01702:Atp11c APN X 60269903 missense probably damaging 0.96
emptyhive UTSW X 60269987 nonsense probably null
hit UTSW X nonsense
R1551:Atp11c UTSW X 60236712 critical splice acceptor site probably null
R2134:Atp11c UTSW X 60276783 missense probably damaging 1.00
R3687:Atp11c UTSW X 60281644 missense probably benign 0.07
R3688:Atp11c UTSW X 60281644 missense probably benign 0.07
R4496:Atp11c UTSW X 60280744 missense probably damaging 0.97
Mode of Inheritance X-linked Recessive
Local Stock Live Mice, Sperm, gDNA
MMRRC Submission 034371-JAX
Last Updated 2016-05-13 3:09 PM by Stephen Lyon
Record Created 2010-03-01 3:39 PM by Carrie N. Arnold
Record Posted 2011-04-29
Phenotypic Description

 

The spelling mutation was discovered during flow cytometry analysis of blood from ENU-mutagenized G3 mice (1). The index mouse and four additional G3 relatives had severely reduced frequencies of peripheral blood B cells and elevated frequencies of CD4+ and CD8+ T cells. The monocyte population was also significantly expanded in the blood of affected mice. Despite the low B cell frequency in the index mouse, it made normal T-independent and T-dependent IgM and IgG responses, respectively (T-dependent Humoral Response Screen and T-independent B Cell Response Screen) (Figure 1).This phenotype resembles that of emptyhive mice, which has a mutation in the Atp11c gene (2).  Compound heterozygosity for both alleles caused a B cell deficiency as severe as either parental strain (Figure 2), indicating that both emptyhive and spelling phenotypes are caused by X-linked recessive loss of function alleles of Atp11c.  Spelling is also allelic to ambrosius and 18NIH30a (3).

Figure 2. Allelism test of spelling and emptyhive alleles. Progeny from an Atp11cspl/Y x Atp11cemp/+ mating were tested from phenotypic complementation by measuring the frequency of B cells in blood.
Nature of Mutation
The Atp11c gene was directly sequenced in genomic DNA from the index spelling mouse and a T to A transversion was detected at position 1214 of the Atp11c transcript, in exon 12 of 30 total exons.
 
1198 CTTTTCAACTTCATTATACCTGTCTCCATGTAT
350  -L--F--N--F--I--I--P--V--S--M--Y-
 
The mutated nucleotide is indicated in red lettering, and converts an isoleucine to lysine at amino acid 355 of the ATP11C protein.
Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 4. Membrane topology of P4-ATPases modeled after the structure of SERCA1 with 10 transmembrane (TM) segments and distinct actuator (A), phosphorylation (P) and nucleotide binding (N) domains. P4-ATPases are proposed to flip phospholipids to the cytosolic membrane layer. Motifs that are important for the catalytic function of P-type ATPases are indicated. Conversion of ATP to ADP by the N-domain leads to phosphorylation of the P-domain and transport of substrate. The A-domain dephosphorylates the P-domain. P4-ATPases can form complexes with CDC50 proteins (pink), which are predicted to have two transmembrane domains and a large, glycosylated ectoplasmic domain. Phosphatidylserines are indicated in dark blue, phosphatidylethanolamine in dark green, and phosphatidylcholine in orange. Although PC is typically localized to the extracellular side of the plasma membrane, it may also be a P4-ATPase substrate. The residue mutated in spelling mice is labeled in red. This image is interactive. Click on the image to view other mutations found in ATP11C (red). Click on the mutations for more specific information.  
The spelling mutation occurs in the fourth transmembrane domain of the ATP11C protein (Figure 4).  It is unknown whether normal levels of the altered ATP11C protein exist in spelling mice or whether the protein is localized appropriately.
 
Please see the record for emptyhive for information about Atp11c.
Expression/Localization
The amino acid altered in spelling mutants occurs in the fourth transmembrane domain of the aminophospholipid transporter ATP11C. The fourth transmembrane domain contains hydrophobic amino acids likely to be necessary for lipid interaction and transport. The I355K change is adjacent to the invariant proline, which is a key structural feature of P-type ATPases and results in unwinding of the transmembrane helical structure. It is likely that alteration of the adjacent isoleucine to a charged lysine critically alters the structure of this region, resulting in loss of protein function. 
Putative Mechanism

The amino acid altered in spelling mutants occurs in the fourth transmembrane domain of the aminophospholipid transporter ATP11C.  The fourth transmembrane domain contains hydrophobic amino acids likely to be necessary for lipid interaction and transport. The I355K change is adjacent to the invariant proline, which is a key structural feature of P-type ATPases and results in unwinding of the transmembrane helical structure.  It is likely that alteration of the adjacent isoleucine to a charged lysine critically alters the structure of this region, resulting in loss of protein function. 

Primers Primers cannot be located by automatic search.
Genotyping

Spelling genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. 

 
Primers
Spell(F): 5’- GGCAAAGTTCCCCATACAATGATGAACC -3’
Spell(R): 5’- GTTCAATGTCATAAGAAATGCACCCCAG -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               8
 
Primers for sequencing
Spell _seq(F): 5'- TGTGATTAGACTAGCCTTCACTG -3'
Spell _seq(R): 5’- CACCTGACCAAGTTCTTCATTAAGG -3’
 
The following sequence of 1166 nucleotides (NCBI Mouse Genome Build 37.1, Chromosome X, bases 57,543,817 to 57,542,652) is amplified:
                                                             
 
ggcaaagttc cccatacaat gatgaaccat ggtataacca aaagactcaa aaggaacggg
aaacttttca ggtaattgct ttgctgtgag aagaattact ctttgtgatt agactagcct
tcactgaaac actactcaga aaaatgagac cttttgattt agatttgttt ttattttata
tatctctatg tttttttgat tctttcatta agagatttga aaagtaatga gctttctggc
attttaattc aatatgaact tgtattccta tctatatatg aattttgaat gtttccatct
atggatagga ggaatttagg acttaatgag gtgaaaaagt attaaagtag aaagctgaaa
aatatagata aaattcatag tgttctaaaa tgttgttaat actaatactt ttgaatataa
tgatatagtg tcattaggaa gtttctttat attaatagtg tgttaagcat taaaacaaaa
gaaagccatt ttatatttta ttcatctaag gctgtgaatc taattaacat gaaccatctc
ttattttagg ttttgaaaat gttcactgac tttttatcat tcatggttct tttcaacttc
attatacctg tctccatgta tgtcacagta gaaatgcaga aatttttagg gtcattcttt
atttcatggg ataaagactt ttttgatgaa gaaattaatg aaggagcctt ggttaataca
tcagacctta atgaagaact tggtcaggtg agaacacagt ttttgcttta attaaactac
tatagtaaaa acattttctg gtctggaata ccaatataag taaccatttc ttttattgac
atataattca aaggaatatc tttagtgtag acaaataatt aaaggtttgc aatattttca
caactgccac ttcagttatt gtttactagt atttttacaa aggataaaat gtatgcattt
aatataaata ttacagaaat ctatataaaa gttcaccaaa cgatactgtc agataaaaac
atgaaatgtg gttttcctta cttcctataa tcaattctga atagaatgaa gtataataaa
atattgctat tttacacatg catgtttgtt aaccatagtt atcctatatt gatattttct
ggggtgcatt tcttatgaca ttgaac
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsCarrie N. Arnold, Elaine Pirie, and Bruce Beutler
Edit History
2011-08-12 3:49 PM (current)
2011-04-29 12:36 PM