Incidental Mutation 'R1208:Fam129c'
ID100532
Institutional Source Beutler Lab
Gene Symbol Fam129c
Ensembl Gene ENSMUSG00000043243
Gene Namefamily with sequence similarity 129, member C
SynonymsBcnp1
MMRRC Submission 039277-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1208 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71597648-71607936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71600475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 125 (T125S)
Ref Sequence ENSEMBL: ENSMUSP00000123432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034264] [ENSMUST00000125339] [ENSMUST00000126559] [ENSMUST00000127626] [ENSMUST00000143441] [ENSMUST00000143662]
Predicted Effect probably benign
Transcript: ENSMUST00000034264
SMART Domains Protein: ENSMUSP00000034264
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 217 2.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124485
Predicted Effect probably benign
Transcript: ENSMUST00000125339
SMART Domains Protein: ENSMUSP00000119708
Gene: ENSMUSG00000043243

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 110 119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125525
Predicted Effect probably benign
Transcript: ENSMUST00000126559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127285
Predicted Effect probably benign
Transcript: ENSMUST00000127626
SMART Domains Protein: ENSMUSP00000122042
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 214 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141594
Predicted Effect probably benign
Transcript: ENSMUST00000143441
SMART Domains Protein: ENSMUSP00000116524
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 134 3.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143662
AA Change: T125S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123432
Gene: ENSMUSG00000043243
AA Change: T125S

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
PH 68 196 4.94e-4 SMART
low complexity region 218 230 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.8%
  • 10x: 91.7%
  • 20x: 74.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A T 16: 30,354,247 C271S probably benign Het
Ccl25 T A 8: 4,357,631 S199T possibly damaging Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cep104 A T 4: 153,985,379 D270V probably damaging Het
Dnah5 T A 15: 28,327,731 Y2084N probably damaging Het
Eftud2 A G 11: 102,864,766 V214A probably benign Het
Epb41l4b C T 4: 57,077,252 probably null Het
Gm8298 C T 3: 59,865,294 P73L probably benign Het
Golgb1 AAGAGAGAGAGAGAGA AAGAGAGAGAGAGA 16: 36,915,205 probably null Het
Gys2 A G 6: 142,450,467 probably null Het
Lig4 T C 8: 9,971,062 E906G probably damaging Het
Mast3 G A 8: 70,788,272 probably null Het
Mta2 G A 19: 8,951,017 R560H probably damaging Het
Myom2 T C 8: 15,084,631 L478P probably damaging Het
Neb A T 2: 52,303,900 L673* probably null Het
Olfr1260 G A 2: 89,978,492 C238Y probably damaging Het
Pdpk1 C A 17: 24,093,609 probably null Het
Perm1 T C 4: 156,217,002 M1T probably null Het
Pphln1 T C 15: 93,459,729 W162R probably damaging Het
Ppp1r13b A G 12: 111,844,905 V183A probably damaging Het
Recql5 T C 11: 115,893,156 K951E probably damaging Het
Slc25a25 T C 2: 32,417,425 E309G probably benign Het
Sycp2 A T 2: 178,356,628 I1033N possibly damaging Het
Tbpl2 A T 2: 24,094,771 N120K probably benign Het
Unc5b A T 10: 60,766,992 L876Q probably damaging Het
Usp9y T C Y: 1,356,282 T1140A probably benign Het
Vmn1r40 A G 6: 89,714,344 I48V probably benign Het
Zbbx T C 3: 75,037,992 I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,412,520 probably benign Het
Other mutations in Fam129c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam129c APN 8 71604863 splice site probably benign
IGL01530:Fam129c APN 8 71603917 splice site probably benign
IGL01553:Fam129c APN 8 71602902 missense possibly damaging 0.86
IGL02313:Fam129c APN 8 71602860 missense possibly damaging 0.92
IGL02341:Fam129c APN 8 71603799 missense possibly damaging 0.60
IGL02541:Fam129c APN 8 71602782 missense probably benign 0.07
IGL02745:Fam129c APN 8 71605038 splice site probably null
R0006:Fam129c UTSW 8 71605044 splice site probably benign
R0391:Fam129c UTSW 8 71602499 splice site probably benign
R0594:Fam129c UTSW 8 71599135 missense probably benign 0.07
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1643:Fam129c UTSW 8 71600164 missense probably benign 0.34
R1848:Fam129c UTSW 8 71603769 missense possibly damaging 0.95
R1986:Fam129c UTSW 8 71603760 missense possibly damaging 0.63
R2319:Fam129c UTSW 8 71602764 missense probably benign 0.00
R4386:Fam129c UTSW 8 71607511 intron probably benign
R4564:Fam129c UTSW 8 71605060 intron probably benign
R4666:Fam129c UTSW 8 71603825 nonsense probably null
R6341:Fam129c UTSW 8 71600077 missense probably damaging 1.00
R6364:Fam129c UTSW 8 71599089 missense probably benign 0.08
R6888:Fam129c UTSW 8 71603739 missense probably benign
R6890:Fam129c UTSW 8 71605671 missense probably damaging 1.00
R7383:Fam129c UTSW 8 71603826 missense possibly damaging 0.86
R7441:Fam129c UTSW 8 71600164 missense probably benign 0.34
R7459:Fam129c UTSW 8 71605027 missense possibly damaging 0.75
R7527:Fam129c UTSW 8 71606698 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCAAGGTCCTGAGTTGCATAG -3'
(R):5'- GTACTCACTCAAGGGTCAATGCCAC -3'

Sequencing Primer
(F):5'- CCTGAGTTGCATAGAGGGC -3'
(R):5'- CATGTTGGAAGTTACACACGCTG -3'
Posted On2014-01-15