Incidental Mutation 'R1163:Smad4'
ID100728
Institutional Source Beutler Lab
Gene Symbol Smad4
Ensembl Gene ENSMUSG00000024515
Gene NameSMAD family member 4
SynonymsDpc4, Smad 4, Madh4, DPC4, D18Wsu70e
MMRRC Submission 039236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1163 (G1)
Quality Score193
Status Not validated
Chromosome18
Chromosomal Location73639009-73703780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73648907 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 428 (I428N)
Ref Sequence ENSEMBL: ENSMUSP00000110589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025393] [ENSMUST00000114939]
Predicted Effect probably damaging
Transcript: ENSMUST00000025393
AA Change: I428N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025393
Gene: ENSMUSG00000024515
AA Change: I428N

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114939
AA Change: I428N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110589
Gene: ENSMUSG00000024515
AA Change: I428N

DomainStartEndE-ValueType
DWA 31 140 5.77e-65 SMART
low complexity region 286 299 N/A INTRINSIC
DWB 320 529 1.41e-123 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147315
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired formation of extraembryonic membrane and endoderm and die prior to gastrulation. Heterozygotes develop polyposis of the glandular stomach and duodenum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T A 10: 87,121,422 Y7N probably damaging Het
4930579F01Rik T G 3: 138,176,510 D18A probably damaging Het
Abca8a T C 11: 110,071,530 D499G probably benign Het
Adamts1 G C 16: 85,802,637 A25G probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Akap3 A G 6: 126,864,787 D123G probably damaging Het
Ankar C T 1: 72,688,705 V350I possibly damaging Het
Apob A G 12: 8,011,654 T3379A probably damaging Het
Ash1l G T 3: 89,035,263 probably null Het
Atp2b1 T C 10: 98,979,851 I119T possibly damaging Het
B3gnt2 A T 11: 22,836,558 M210K probably benign Het
Bcl11a A G 11: 24,165,143 N829D probably benign Het
Btnl4 T C 17: 34,470,075 E337G possibly damaging Het
Casr A T 16: 36,494,807 V967D probably damaging Het
Cd200 A T 16: 45,392,352 V244D probably damaging Het
Cd200r4 A G 16: 44,838,020 N256D probably benign Het
Cep68 A G 11: 20,240,539 S158P probably damaging Het
Chst10 A T 1: 38,871,702 V123D probably damaging Het
Cobll1 T C 2: 65,098,279 H938R probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dmkn T G 7: 30,765,051 C205G probably damaging Het
Dock8 A G 19: 25,051,503 I24V probably benign Het
Dpp3 C T 19: 4,914,923 W488* probably null Het
Dpp9 C A 17: 56,199,426 A365S possibly damaging Het
Egfr A T 11: 16,883,546 T605S probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam83g T C 11: 61,703,436 S599P probably damaging Het
Fscn1 G T 5: 142,960,843 W132L probably damaging Het
Gbp2b A G 3: 142,599,096 T98A probably damaging Het
Gm13088 A G 4: 143,656,634 L5P probably damaging Het
Gm4922 C T 10: 18,783,721 A418T possibly damaging Het
Golgb1 G T 16: 36,916,126 V1912L possibly damaging Het
Gon4l T C 3: 88,892,535 L829P probably damaging Het
Grm3 T A 5: 9,570,738 I169L probably benign Het
Gsdma2 A G 11: 98,650,858 D137G probably damaging Het
Hhip T C 8: 79,992,476 Y474C probably damaging Het
Hsph1 A T 5: 149,630,801 V163E probably damaging Het
Ifi203 T C 1: 173,924,137 K373E probably damaging Het
Itsn2 A G 12: 4,712,009 T1540A probably benign Het
Kdm1b T C 13: 47,071,922 V527A probably benign Het
Kdm5d G A Y: 898,029 A22T probably benign Het
Khdrbs1 A T 4: 129,725,586 F254Y possibly damaging Het
Kif26a T C 12: 112,179,945 F1822L probably benign Het
Krt1 C A 15: 101,848,165 E308* probably null Het
Lrrc47 T A 4: 154,011,817 M1K probably null Het
Mrgpra4 A T 7: 47,981,476 W126R probably damaging Het
Nlrp4e G A 7: 23,320,972 V295I probably benign Het
Olfr1100 A G 2: 86,978,676 L40P probably damaging Het
Olfr1258 G T 2: 89,930,105 V99F possibly damaging Het
Olfr1446 T A 19: 12,890,149 T143S probably benign Het
Olfr201 A G 16: 59,269,155 S171P probably benign Het
Olfr206 A T 16: 59,345,062 I213N probably damaging Het
Olfr228 A T 2: 86,483,238 F168Y probably damaging Het
Olfr364-ps1 A T 2: 37,147,027 T272S probably damaging Het
Olfr453 G A 6: 42,744,123 V29I probably benign Het
Olfr798 A G 10: 129,625,647 V138A possibly damaging Het
Plec G T 15: 76,183,838 N1190K possibly damaging Het
Plin1 T C 7: 79,729,971 T44A probably damaging Het
Pou3f2 TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 4: 22,487,697 probably benign Het
Psg27 A G 7: 18,565,309 L29P probably damaging Het
Psmd13 C A 7: 140,897,454 T292N probably damaging Het
Rab1b A T 19: 5,104,656 Y88* probably null Het
Reln T A 5: 21,899,029 I3315L probably benign Het
Rmdn2 A T 17: 79,659,451 M257L probably benign Het
Rnd1 A T 15: 98,676,554 F47L probably damaging Het
Rnf41 G A 10: 128,438,207 V243I probably benign Het
Rnf43 C G 11: 87,729,513 S226R probably damaging Het
Scn5a A T 9: 119,533,927 D542E probably damaging Het
Sema5b A T 16: 35,628,096 I81F probably benign Het
Serinc5 G A 13: 92,682,777 C73Y probably damaging Het
Serpina3g A T 12: 104,239,292 N97Y possibly damaging Het
Shq1 A G 6: 100,637,072 S262P probably damaging Het
Snip1 G T 4: 125,072,820 G348W probably damaging Het
Spg11 A G 2: 122,070,941 L1506P probably damaging Het
Stard9 G A 2: 120,696,213 V984I possibly damaging Het
Svopl A T 6: 38,029,700 F121I possibly damaging Het
Tjp1 A T 7: 65,323,054 V546E probably damaging Het
Tmem116 T A 5: 121,493,756 F110L probably damaging Het
Ttyh2 C T 11: 114,710,888 T446M probably benign Het
Tubb1 A T 2: 174,457,739 I405L probably benign Het
Uba5 A T 9: 104,055,826 F155L possibly damaging Het
Ubd C T 17: 37,195,321 H33Y probably damaging Het
Ube2cbp A T 9: 86,440,595 D175E probably benign Het
Usp24 A G 4: 106,420,960 Q2293R probably benign Het
Vmn1r175 T A 7: 23,808,512 H230L probably benign Het
Vmn1r88 A G 7: 13,178,133 I139V probably benign Het
Vmn2r1 T C 3: 64,086,625 F131L probably benign Het
Yipf3 T C 17: 46,251,229 probably null Het
Zdhhc19 A G 16: 32,506,440 K192R probably benign Het
Zfy1 G A Y: 725,611 T718I probably damaging Het
Other mutations in Smad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Smad4 APN 18 73675809 missense probably damaging 1.00
IGL01647:Smad4 APN 18 73640473 splice site probably benign
IGL02055:Smad4 APN 18 73641928 splice site probably benign
IGL02101:Smad4 APN 18 73658652 missense probably benign 0.02
IGL02306:Smad4 APN 18 73662869 critical splice acceptor site probably null
R0391:Smad4 UTSW 18 73658649 missense probably benign
R1118:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1211:Smad4 UTSW 18 73649911 critical splice acceptor site probably null
R1616:Smad4 UTSW 18 73640262 missense probably benign 0.41
R1742:Smad4 UTSW 18 73675897 missense probably damaging 1.00
R1829:Smad4 UTSW 18 73641894 missense probably benign 0.20
R2045:Smad4 UTSW 18 73649806 nonsense probably null
R2126:Smad4 UTSW 18 73662744 missense probably benign 0.02
R3013:Smad4 UTSW 18 73648904 missense probably damaging 1.00
R3973:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3974:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R3975:Smad4 UTSW 18 73677736 missense possibly damaging 0.49
R4879:Smad4 UTSW 18 73641903 missense probably damaging 1.00
R5101:Smad4 UTSW 18 73675860 missense probably benign 0.41
R5597:Smad4 UTSW 18 73662827 missense probably benign
R5984:Smad4 UTSW 18 73677911 start codon destroyed probably benign 0.29
R6450:Smad4 UTSW 18 73677746 missense possibly damaging 0.73
Predicted Primers
Posted On2014-01-15