Incidental Mutation 'R1241:Vmn2r60'
ID151997
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 039308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1241 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42137052 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 426 (N426K)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably benign
Transcript: ENSMUST00000166447
AA Change: N426K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: N426K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
9030619P08Rik A C 15: 75,429,997 noncoding transcript Het
Aldh1l2 T C 10: 83,496,025 I639V probably benign Het
Ambra1 T C 2: 91,770,896 probably benign Het
Ap5z1 T C 5: 142,470,114 Y299H probably damaging Het
Atp6v1b1 A T 6: 83,756,544 probably benign Het
Atr G A 9: 95,950,636 V2574I probably benign Het
Atxn1l T A 8: 109,732,980 T217S probably benign Het
Ccdc85a A G 11: 28,396,150 S89P probably benign Het
Cd209e A T 8: 3,849,124 I196N probably damaging Het
Cdhr4 A G 9: 107,995,296 S247G probably benign Het
Cntn6 A T 6: 104,832,509 I502F probably damaging Het
Crisp4 T C 1: 18,122,794 Y233C probably damaging Het
Ctsb C A 14: 63,139,104 T261N probably benign Het
Ctsk T C 3: 95,500,874 F14L probably benign Het
Dchs1 T C 7: 105,758,178 I2110V probably damaging Het
Dennd5b A G 6: 149,068,490 M155T probably benign Het
Echdc3 T C 2: 6,212,800 D54G probably benign Het
Egln3 G A 12: 54,181,693 T209I probably damaging Het
Fbn1 A C 2: 125,372,527 probably benign Het
Fkbp15 A T 4: 62,304,609 S1018T possibly damaging Het
Flnb T C 14: 7,896,503 I898T probably benign Het
Flt1 T A 5: 147,599,646 Y795F probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fryl A G 5: 73,064,925 probably benign Het
Fryl T C 5: 73,110,271 E417G probably damaging Het
Gcnt3 T C 9: 70,034,333 I318V probably benign Het
Gm11437 T A 11: 84,164,628 H54L possibly damaging Het
Huwe1 AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA X: 151,907,048 probably benign Het
Jarid2 G A 13: 44,884,892 probably benign Het
Kif5b A T 18: 6,214,044 V653E probably benign Het
Kmt2b A G 7: 30,574,940 V2113A probably damaging Het
Knl1 C T 2: 119,072,573 T1585I probably benign Het
Mlxipl T A 5: 135,132,718 M497K probably benign Het
Mre11a T A 9: 14,799,639 W210R probably damaging Het
Mrps22 A G 9: 98,594,695 V207A probably benign Het
Myo15 A G 11: 60,499,430 I2111V possibly damaging Het
Myo1a C T 10: 127,719,279 P838L probably benign Het
Nbea T A 3: 56,058,040 H484L probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nlrp2 T A 7: 5,328,431 D322V probably damaging Het
Nrcam T C 12: 44,590,164 C1057R probably damaging Het
Ntsr1 T C 2: 180,500,601 S62P probably damaging Het
Nudt18 A G 14: 70,579,427 H157R probably benign Het
Olfr1002 T A 2: 85,647,560 T254S probably damaging Het
Olfr982 C A 9: 40,074,896 N200K probably damaging Het
Sidt2 T C 9: 45,945,704 T435A probably damaging Het
Snx27 T C 3: 94,520,233 T312A probably benign Het
Srebf2 T C 15: 82,177,519 S429P probably damaging Het
Suclg2 A G 6: 95,497,582 probably benign Het
Tchh A T 3: 93,444,972 E573V unknown Het
Tdrd1 A G 19: 56,861,760 T985A probably benign Het
Ttc7b A G 12: 100,403,439 I357T possibly damaging Het
Ttn T C 2: 76,795,664 E13271G probably damaging Het
Usp13 A G 3: 32,915,708 E661G probably damaging Het
Vasp T G 7: 19,259,033 probably benign Het
Vmn2r109 A T 17: 20,555,241 Y75N possibly damaging Het
Vmn2r15 T A 5: 109,292,904 N363Y probably damaging Het
Wisp2 T A 2: 163,829,077 M168K unknown Het
Znhit2 C A 19: 6,062,258 N344K probably damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7529:Vmn2r60 UTSW 7 42195734 frame shift probably null
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAAAGTCTGGGTCTTGAACTCTTCAT -3'
(R):5'- CCCTCTCTTGCTTATTGACAGCATAGTC -3'

Sequencing Primer
(F):5'- CATGGGATGTTGATAGCCACTC -3'
(R):5'- TGCTTATTGACAGCATAGTCTAAAAC -3'
Posted On2014-01-29