Incidental Mutation 'R1233:Cdh16'
ID152353
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1233 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104618482 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 392 (A392T)
Ref Sequence ENSEMBL: ENSMUSP00000148478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163783
AA Change: A362T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: A362T

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect possibly damaging
Transcript: ENSMUST00000211903
AA Change: A392T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect probably benign
Transcript: ENSMUST00000212420
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect possibly damaging
Transcript: ENSMUST00000212882
AA Change: A392T

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,199,520 M631K probably damaging Het
Ache A G 5: 137,290,157 probably null Het
Arfgef1 T C 1: 10,184,090 D773G probably damaging Het
Arhgap45 T C 10: 80,027,582 I753T probably damaging Het
Cd274 T A 19: 29,373,901 probably null Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Exosc8 A T 3: 54,731,998 C129S probably benign Het
Fat3 T G 9: 15,922,745 I4184L probably benign Het
Frem2 A G 3: 53,547,778 Y2126H probably damaging Het
Fsbp T C 4: 11,580,053 M107T possibly damaging Het
Gper1 A G 5: 139,426,602 Y234C probably damaging Het
Hmcn1 T C 1: 150,749,026 S1043G probably benign Het
Kif2a T A 13: 106,987,332 K137N probably damaging Het
Mrc2 T C 11: 105,348,415 F1332S probably damaging Het
Nme8 T A 13: 19,660,512 M375L possibly damaging Het
Olfr392 T A 11: 73,814,350 H244L probably damaging Het
Per1 T C 11: 69,102,211 L298P probably damaging Het
Polr2b A G 5: 77,334,565 N650S probably benign Het
Ppara T C 15: 85,798,021 V306A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Repin1 A G 6: 48,597,834 T566A possibly damaging Het
Rhot2 T A 17: 25,844,097 D57V probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc5a8 C A 10: 88,918,442 P435H probably damaging Het
Stpg1 G A 4: 135,525,429 A164T probably benign Het
Tll2 G T 19: 41,095,984 A668D possibly damaging Het
Txnl1 T A 18: 63,675,468 M180L probably benign Het
Vopp1 A C 6: 57,789,995 L32R probably damaging Het
Wdr95 C T 5: 149,581,858 T226I possibly damaging Het
Wdr95 C A 5: 149,595,364 Q557K probably benign Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R0016:Cdh16 UTSW 8 104617632 missense probably benign 0.22
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1752:Cdh16 UTSW 8 104619873 critical splice donor site probably null
R1892:Cdh16 UTSW 8 104617999 missense possibly damaging 0.69
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 unclassified probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 104619985 nonsense probably null
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCTGTCACCATGACTGTCACC -3'
(R):5'- AACGACAATGCACCTGTCTGCTCC -3'

Sequencing Primer
(F):5'- ACATGTGCTGCTGAGGC -3'
(R):5'- acacacacacacacacacc -3'
Posted On2014-01-29