Incidental Mutation 'R1356:Mctp2'
ID156324
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Namemultiple C2 domains, transmembrane 2
SynonymsLOC244049
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1356 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location72077830-72306608 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 72164723 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323] [ENSMUST00000205410]
Predicted Effect probably benign
Transcript: ENSMUST00000079323
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205410
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Krt9 CTGC CTGCNNNNNNNNNNNNNNNNNNNNNTGC 11: 100,188,814 probably benign Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 72185815 missense probably damaging 0.96
IGL01296:Mctp2 APN 7 72228526 missense probably benign 0.03
IGL01509:Mctp2 APN 7 72259269 missense probably benign 0.01
IGL02074:Mctp2 APN 7 72161258 missense probably damaging 0.99
IGL02185:Mctp2 APN 7 72080823 missense probably benign 0.13
IGL02238:Mctp2 APN 7 72090205 nonsense probably null
IGL02707:Mctp2 APN 7 72259341 missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 72245542 missense probably damaging 0.99
IGL02869:Mctp2 APN 7 72228471 critical splice donor site probably null
IGL03354:Mctp2 APN 7 72161244 missense probably benign 0.00
IGL03397:Mctp2 APN 7 72259277 missense probably damaging 0.98
IGL03407:Mctp2 APN 7 72211652 missense probably benign 0.05
F5770:Mctp2 UTSW 7 72121751 splice site probably benign
PIT4131001:Mctp2 UTSW 7 72090257 missense probably damaging 1.00
R0013:Mctp2 UTSW 7 72229408 missense probably benign 0.00
R0079:Mctp2 UTSW 7 72214116 splice site probably benign
R0083:Mctp2 UTSW 7 72228516 missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 72247107 critical splice donor site probably null
R0302:Mctp2 UTSW 7 72090264 missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 72080822 missense probably benign 0.00
R0675:Mctp2 UTSW 7 72083170 missense probably damaging 1.00
R1076:Mctp2 UTSW 7 72185867 critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 72259139 missense probably benign
R1628:Mctp2 UTSW 7 72211589 splice site probably null
R1649:Mctp2 UTSW 7 72161258 missense probably damaging 0.99
R1981:Mctp2 UTSW 7 72164698 missense probably benign 0.01
R2256:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2257:Mctp2 UTSW 7 72185820 missense probably damaging 1.00
R2327:Mctp2 UTSW 7 72211610 missense probably damaging 0.99
R2407:Mctp2 UTSW 7 72200407 missense probably benign 0.40
R2471:Mctp2 UTSW 7 72161161 nonsense probably null
R3706:Mctp2 UTSW 7 72214111 splice site probably benign
R4023:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 72090239 missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 72259337 missense probably benign
R4272:Mctp2 UTSW 7 72259331 missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 72183851 missense probably damaging 1.00
R4654:Mctp2 UTSW 7 72090194 missense probably damaging 1.00
R4815:Mctp2 UTSW 7 72259349 missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 72259269 missense probably benign 0.00
R5389:Mctp2 UTSW 7 72214087 missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 72245459 critical splice donor site probably null
R5878:Mctp2 UTSW 7 72214108 missense probably benign 0.01
R5918:Mctp2 UTSW 7 72228540 missense probably damaging 1.00
R5956:Mctp2 UTSW 7 72259175 missense probably benign
R5964:Mctp2 UTSW 7 72103177 missense probably damaging 0.97
R5978:Mctp2 UTSW 7 72090188 missense probably damaging 1.00
R6054:Mctp2 UTSW 7 72259103 missense probably benign
R6475:Mctp2 UTSW 7 72200344 critical splice donor site probably null
R6849:Mctp2 UTSW 7 72211718 missense probably damaging 1.00
R6963:Mctp2 UTSW 7 72228056 missense probably damaging 1.00
R7366:Mctp2 UTSW 7 72259214 missense probably benign 0.00
X0066:Mctp2 UTSW 7 72259280 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTGAGAAGCTGGGAGGCACACC -3'
(R):5'- TTGGTCACCAGAATGGGGAGGGGTC -3'

Sequencing Primer
(F):5'- ACCGGGAGGGCACTTAC -3'
(R):5'- AATCCATTTTTGCAGAGGCAA -3'
Posted On2014-02-11