Incidental Mutation 'R1325:Fgd6'
ID157189
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
MMRRC Submission 039391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R1325 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 94127427 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1129 (R1129H)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure
Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000020208
AA Change: R1129H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: R1129H

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,495,127 I293T possibly damaging Het
Abca14 A G 7: 120,247,322 I666V probably benign Het
Acsl1 G A 8: 46,513,300 V164I probably benign Het
Aox3 C T 1: 58,176,567 Q1053* probably null Het
Arhgap31 A G 16: 38,602,942 S921P probably benign Het
Bcl6 A G 16: 23,972,347 M419T probably benign Het
Bdp1 A G 13: 100,099,008 I145T probably damaging Het
Btaf1 T C 19: 36,969,162 V456A possibly damaging Het
Cry2 T C 2: 92,413,770 T353A probably damaging Het
Dcxr A G 11: 120,726,555 probably null Het
Echdc1 A T 10: 29,317,548 T14S probably benign Het
Fstl1 A G 16: 37,828,721 D197G probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Krt1 A T 15: 101,848,206 probably null Het
Lrrc9 C A 12: 72,497,104 Q1116K probably damaging Het
Ncor2 T C 5: 125,118,780 probably benign Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Olfr531 G A 7: 140,400,881 P55L probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Slc17a6 A G 7: 51,661,552 E338G probably benign Het
Ttn A G 2: 76,900,394 probably benign Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGCATTTGAGTCTGTCCAGAATGTAG -3'
(R):5'- CAGTATCATTATCTAGAGGCACACGGC -3'

Sequencing Primer
(F):5'- AGTCTGTCCAGAATGTAGAGTCC -3'
(R):5'- gattaaagctgtgtgccacc -3'
Posted On2014-02-18