Incidental Mutation 'R6735:Fgd6'
ID530190
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94074320 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 829 (E829V)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure
Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020208
AA Change: E829V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: E829V

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141143
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R7181:Fgd6 UTSW 10 94043511 missense probably benign 0.02
R7210:Fgd6 UTSW 10 94134092 missense probably damaging 0.98
R7296:Fgd6 UTSW 10 94044047 nonsense probably null
R7296:Fgd6 UTSW 10 94139881 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTCTCACATGGCCAGGATG -3'
(R):5'- AACAAACTTAAGCCTTTGCAGC -3'

Sequencing Primer
(F):5'- CAGGATGAGGGACCTGGTTC -3'
(R):5'- AAACTTAAGCCTTTGCAGCCTCTC -3'
Posted On2018-08-01