Mutagenetix > Incidental Mutation

Incidental Mutation 'R1328:Mast1'

157283

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

9430008B02Rik, SAST, SAST170

MMRRC Submission

039394-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1328 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85638532-85663988 bp(-) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 85644617 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably benign
Transcript: ENSMUST00000109741

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119820

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.9%

Validation Efficiency

100% (37/37)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp4	C	T	7: 43,906,516 (GRCm39)		probably null	Het
Bcap29	T	C	12: 31,680,807 (GRCm39)	I60V	probably benign	Het
Ccdc71	T	A	9: 108,340,148 (GRCm39)		probably benign	Het
Ccnb1ip1	A	T	14: 51,027,382 (GRCm39)	V240E	probably benign	Het
Copa	C	T	1: 171,949,258 (GRCm39)		probably benign	Het
Dmxl2	G	T	9: 54,303,533 (GRCm39)	Q2314K	probably benign	Het
Fam181b	T	C	7: 92,729,437 (GRCm39)	I70T	probably damaging	Het
Fbxl14	T	C	6: 119,457,347 (GRCm39)	L176P	possibly damaging	Het
Fip1l1	T	A	5: 74,706,796 (GRCm39)	F144L	possibly damaging	Het
Flnc	T	C	6: 29,438,612 (GRCm39)	W169R	probably damaging	Het
H2-M3	T	C	17: 37,581,925 (GRCm39)	V127A	possibly damaging	Het
Il23r	T	A	6: 67,468,802 (GRCm39)		probably benign	Het
Krt18	C	T	15: 101,939,169 (GRCm39)	A251V	probably benign	Het
Or6c202	A	G	10: 128,996,293 (GRCm39)	S187P	possibly damaging	Het
Or9i14	G	A	19: 13,792,900 (GRCm39)	T18I	probably benign	Het
Pkhd1l1	T	C	15: 44,361,392 (GRCm39)	Y481H	probably benign	Het
Polr3e	C	T	7: 120,533,046 (GRCm39)		probably benign	Het
Pou4f2	G	A	8: 79,162,759 (GRCm39)	A92V	probably benign	Het
Pramel5	A	G	4: 143,998,058 (GRCm39)	L395P	probably damaging	Het
Prmt9	T	C	8: 78,299,283 (GRCm39)	I659T	possibly damaging	Het
Rin2	C	T	2: 145,702,366 (GRCm39)	T354I	probably benign	Het
Rrp36	T	A	17: 46,983,705 (GRCm39)	K36*	probably null	Het
Sag	G	A	1: 87,738,016 (GRCm39)		probably benign	Het
Setd7	T	C	3: 51,450,240 (GRCm39)	Y62C	possibly damaging	Het
Smr2	AT	ATT	5: 88,256,683 (GRCm39)		probably null	Het
Sox13	T	C	1: 133,311,555 (GRCm39)	D559G	probably damaging	Het
Srd5a1	T	A	13: 69,723,310 (GRCm39)	Y236F	probably damaging	Het
Stxbp2	A	T	8: 3,692,657 (GRCm39)	I570F	possibly damaging	Het
Tbc1d31	T	C	15: 57,805,859 (GRCm39)		probably benign	Het
Trim33	A	G	3: 103,260,913 (GRCm39)	T1064A	possibly damaging	Het
Vmn1r8	T	C	6: 57,013,278 (GRCm39)	S110P	possibly damaging	Het
Vmn2r118	C	A	17: 55,915,620 (GRCm39)	M443I	probably benign	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	85,639,444 (GRCm39)	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	85,639,875 (GRCm39)	splice site	probably null
IGL01918:Mast1	APN	8	85,647,838 (GRCm39)	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	85,648,026 (GRCm39)	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	85,645,384 (GRCm39)	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	85,638,883 (GRCm39)	missense	probably benign
IGL02470:Mast1	APN	8	85,647,841 (GRCm39)	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	85,644,400 (GRCm39)	missense	probably benign
IGL02716:Mast1	APN	8	85,662,352 (GRCm39)	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	85,652,348 (GRCm39)	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	85,639,982 (GRCm39)	missense	probably benign	0.01
R0255:Mast1	UTSW	8	85,638,650 (GRCm39)	missense	probably benign
R0388:Mast1	UTSW	8	85,642,166 (GRCm39)	missense	probably benign	0.13
R0480:Mast1	UTSW	8	85,639,718 (GRCm39)	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	85,648,044 (GRCm39)	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	85,651,956 (GRCm39)	missense	probably benign	0.29
R1297:Mast1	UTSW	8	85,639,345 (GRCm39)	missense	probably benign	0.05
R1454:Mast1	UTSW	8	85,647,264 (GRCm39)	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	85,655,238 (GRCm39)	nonsense	probably null
R1752:Mast1	UTSW	8	85,651,965 (GRCm39)	missense	probably benign
R1777:Mast1	UTSW	8	85,638,697 (GRCm39)	missense	probably benign
R1905:Mast1	UTSW	8	85,642,895 (GRCm39)	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	85,642,895 (GRCm39)	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	85,642,895 (GRCm39)	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	85,646,995 (GRCm39)	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	85,647,823 (GRCm39)	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	85,648,107 (GRCm39)	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	85,647,754 (GRCm39)	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	85,650,537 (GRCm39)	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	85,645,360 (GRCm39)	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	85,662,352 (GRCm39)	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	85,645,393 (GRCm39)	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	85,647,520 (GRCm39)	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	85,647,990 (GRCm39)	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	85,655,635 (GRCm39)	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	85,655,875 (GRCm39)	missense	probably benign	0.02
R4776:Mast1	UTSW	8	85,663,822 (GRCm39)	critical splice donor site	probably null
R4835:Mast1	UTSW	8	85,650,408 (GRCm39)	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	85,647,287 (GRCm39)	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	85,645,357 (GRCm39)	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	85,644,500 (GRCm39)	missense	probably benign
R4978:Mast1	UTSW	8	85,662,416 (GRCm39)	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	85,640,147 (GRCm39)	unclassified	probably benign
R5235:Mast1	UTSW	8	85,640,068 (GRCm39)	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	85,639,947 (GRCm39)	critical splice donor site	probably null
R5463:Mast1	UTSW	8	85,652,136 (GRCm39)	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	85,642,889 (GRCm39)	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	85,655,597 (GRCm39)	nonsense	probably null
R6124:Mast1	UTSW	8	85,651,936 (GRCm39)	missense	probably benign	0.01
R6213:Mast1	UTSW	8	85,642,198 (GRCm39)	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	85,644,383 (GRCm39)	missense	probably benign
R7000:Mast1	UTSW	8	85,655,598 (GRCm39)	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	85,638,574 (GRCm39)	nonsense	probably null
R7164:Mast1	UTSW	8	85,661,933 (GRCm39)	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	85,647,557 (GRCm39)	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	85,651,954 (GRCm39)	nonsense	probably null
R7882:Mast1	UTSW	8	85,639,947 (GRCm39)	critical splice donor site	probably null
R8167:Mast1	UTSW	8	85,647,987 (GRCm39)	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	85,639,450 (GRCm39)	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	85,642,953 (GRCm39)	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	85,638,779 (GRCm39)	missense	probably benign	0.18
R9526:Mast1	UTSW	8	85,647,805 (GRCm39)	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	85,657,474 (GRCm39)	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	85,650,660 (GRCm39)	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	85,647,507 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	85,645,310 (GRCm39)	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	85,639,088 (GRCm39)	missense	probably damaging	0.97
Z1177:Mast1	UTSW	8	85,647,075 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AGGATGCTCAATAGATCGCCCGTG -3'
(R):5'- CGGTTGCAGAAAACTGATTGGCTC -3'

Sequencing Primer
(F):5'- ATAGATCGCCCGTGGAACTG -3'
(R):5'- TGTCTCAGCACGAGCCTAAG -3'

Posted On

2014-02-18