Incidental Mutation 'R1318:Kcnj3'
ID 157591
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Name potassium inwardly-rectifying channel, subfamily J, member 3
Synonyms GIRK1, Kcnf3, Kir3.1
MMRRC Submission 039384-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1318 (G1)
Quality Score 152
Status Not validated
Chromosome 2
Chromosomal Location 55325982-55488157 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55327750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 180 (M180L)
Ref Sequence ENSEMBL: ENSMUSP00000108251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
AlphaFold P63250
Predicted Effect possibly damaging
Transcript: ENSMUST00000067101
AA Change: M180L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: M180L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112632
AA Change: M180L

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824
AA Change: M180L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112633
AA Change: M180L

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: M180L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180810
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.9%
  • 20x: 82.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G T 5: 8,751,621 (GRCm39) V334L probably benign Het
Alms1 T G 6: 85,605,531 (GRCm39) S1925A possibly damaging Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Comt G T 16: 18,226,641 (GRCm39) D248E probably damaging Het
Ctnna2 A C 6: 76,859,773 (GRCm39) N874K probably damaging Het
Dnah7b C T 1: 46,138,669 (GRCm39) P237L possibly damaging Het
Galnt4 T G 10: 98,945,772 (GRCm39) V499G probably damaging Het
Gh T C 11: 106,191,923 (GRCm39) T96A probably benign Het
Gng8 T C 7: 16,629,161 (GRCm39) V29A probably damaging Het
Hnrnpu G A 1: 178,157,822 (GRCm39) probably benign Het
Igdcc4 T C 9: 65,040,972 (GRCm39) L1001P probably damaging Het
Jph1 A C 1: 17,067,714 (GRCm39) F658V probably damaging Het
Ldb2 C T 5: 44,692,379 (GRCm39) probably null Het
Mettl2 C A 11: 105,028,597 (GRCm39) Y316* probably null Het
Mug2 G A 6: 122,054,361 (GRCm39) V1047M probably damaging Het
Mxra8 G T 4: 155,925,956 (GRCm39) C140F probably damaging Het
Mylip T C 13: 45,559,401 (GRCm39) I101T probably benign Het
Oasl2 A G 5: 115,039,442 (GRCm39) N210S probably benign Het
Pclo A G 5: 14,729,328 (GRCm39) probably benign Het
Plaat3 T A 19: 7,556,591 (GRCm39) probably null Het
Rims2 G A 15: 39,381,222 (GRCm39) R1051H probably damaging Het
Rnf4 C A 5: 34,508,590 (GRCm39) R151S probably damaging Het
Serpina11 A T 12: 103,952,777 (GRCm39) probably benign Het
Trim30b T A 7: 104,006,542 (GRCm39) T105S possibly damaging Het
Ttn T C 2: 76,706,164 (GRCm39) probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Zranb1 C A 7: 132,568,281 (GRCm39) S313* probably null Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55,485,284 (GRCm39) missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55,327,216 (GRCm39) missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55,327,243 (GRCm39) missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55,327,243 (GRCm39) missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55,327,243 (GRCm39) missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55,327,590 (GRCm39) missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55,484,971 (GRCm39) nonsense probably null
R0565:Kcnj3 UTSW 2 55,485,276 (GRCm39) missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55,327,235 (GRCm39) missense possibly damaging 0.69
R1592:Kcnj3 UTSW 2 55,327,898 (GRCm39) missense probably damaging 1.00
R1756:Kcnj3 UTSW 2 55,327,232 (GRCm39) missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55,327,256 (GRCm39) missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55,327,343 (GRCm39) missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55,337,027 (GRCm39) missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55,337,027 (GRCm39) missense probably damaging 1.00
R2893:Kcnj3 UTSW 2 55,337,027 (GRCm39) missense probably damaging 1.00
R3901:Kcnj3 UTSW 2 55,327,360 (GRCm39) missense possibly damaging 0.46
R4470:Kcnj3 UTSW 2 55,327,877 (GRCm39) missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55,336,991 (GRCm39) nonsense probably null
R4694:Kcnj3 UTSW 2 55,484,918 (GRCm39) missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55,327,590 (GRCm39) missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55,337,059 (GRCm39) splice site probably null
R5332:Kcnj3 UTSW 2 55,327,559 (GRCm39) missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55,327,330 (GRCm39) missense probably benign 0.10
R6352:Kcnj3 UTSW 2 55,327,561 (GRCm39) missense probably benign 0.06
R7042:Kcnj3 UTSW 2 55,484,877 (GRCm39) missense possibly damaging 0.87
R7475:Kcnj3 UTSW 2 55,327,338 (GRCm39) missense probably benign 0.09
R7626:Kcnj3 UTSW 2 55,484,833 (GRCm39) nonsense probably null
R7771:Kcnj3 UTSW 2 55,336,949 (GRCm39) missense probably damaging 1.00
R8225:Kcnj3 UTSW 2 55,327,726 (GRCm39) missense probably damaging 1.00
R8558:Kcnj3 UTSW 2 55,336,875 (GRCm39) missense possibly damaging 0.91
R8986:Kcnj3 UTSW 2 55,485,039 (GRCm39) missense probably benign
R9653:Kcnj3 UTSW 2 55,484,864 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCTCAAGTGGCGTTGGAACC -3'
(R):5'- AAGGGGAGGGCTGCACTTACTTTG -3'

Sequencing Primer
(F):5'- GGCAACTACACTCCCTGTG -3'
(R):5'- ACTTTGAGCAGCTTGCAGC -3'
Posted On 2014-02-18