Incidental Mutation 'R1302:Polr3b'
ID158435
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Namepolymerase (RNA) III (DNA directed) polypeptide B
SynonymsRPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission 039368-MU
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1302 (G1)
Quality Score90
Status Not validated
Chromosome10
Chromosomal Location84622292-84727178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84632486 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 112 (P112L)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
Predicted Effect probably damaging
Transcript: ENSMUST00000077175
AA Change: P112L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: P112L

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213263
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTGTTTCCACGCCAAGCACAC -3'
(R):5'- GTAAACCACAGCTCTGTCTGGTCC -3'

Sequencing Primer
(F):5'- CACATGTTCTAAACACAACTGTGAC -3'
(R):5'- accatttcccacacccttc -3'
Posted On2014-02-18