Incidental Mutation 'R0445:Pex10'
ID158489
Institutional Source Beutler Lab
Gene Symbol Pex10
Ensembl Gene ENSMUSG00000029047
Gene Nameperoxisomal biogenesis factor 10
Synonymsperoxisome biogenesis factor 10, LOC230983
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R0445 (G1)
Quality Score46
Status Validated
Chromosome4
Chromosomal Location155067016-155072433 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 155069074 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103180]
Predicted Effect probably null
Transcript: ENSMUST00000103180
SMART Domains Protein: ENSMUSP00000099469
Gene: ENSMUSG00000029047

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 16 241 2.3e-43 PFAM
low complexity region 248 260 N/A INTRINSIC
RING 271 308 4.48e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134341
Meta Mutation Damage Score 0.6216 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in import of peroxisomal matrix proteins. This protein localizes to the peroxisomal membrane. Mutations in this gene result in phenotypes within the Zellweger spectrum of peroxisomal biogenesis disorders, ranging from neonatal adrenoleukodystrophy to Zellweger syndrome. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial neonatal mortality due to respiratory distress, loss of embryonic movement, and prenatal pathology including altered biochemistry, defects in axonal integrity, decreased Schwann cell number, and defects at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Gpr155 G A 2: 73,370,144 probably benign Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Pex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02487:Pex10 APN 4 155070733 missense probably damaging 1.00
IGL03179:Pex10 APN 4 155067897 missense probably benign
IGL03014:Pex10 UTSW 4 155070619 intron probably benign
R0088:Pex10 UTSW 4 155070498 missense probably damaging 0.98
R4191:Pex10 UTSW 4 155067905 critical splice donor site probably null
R4544:Pex10 UTSW 4 155070495 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACCTGCTAGACAAGGCACTGCTG -3'
(R):5'- TGAGGCGATGTACTCACTCTAGGAC -3'

Sequencing Primer
(F):5'- TTCACAGGGCAGTCTGCTAC -3'
(R):5'- CACCTTCAGTCTGTGGGAAC -3'
Posted On2014-02-20