Incidental Mutation 'R0078:Nr4a2'
ID158520
Institutional Source Beutler Lab
Gene Symbol Nr4a2
Ensembl Gene ENSMUSG00000026826
Gene Namenuclear receptor subfamily 4, group A, member 2
SynonymsRNR-1, HZF-3, Nurr1
MMRRC Submission 038365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location57106830-57124003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57112228 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 8 (Y8C)
Ref Sequence ENSEMBL: ENSMUSP00000138824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028166] [ENSMUST00000112627] [ENSMUST00000112629] [ENSMUST00000183542]
Predicted Effect probably benign
Transcript: ENSMUST00000028166
AA Change: Y71C

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028166
Gene: ENSMUSG00000026826
AA Change: Y71C

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112627
AA Change: Y8C

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108246
Gene: ENSMUSG00000026826
AA Change: Y8C

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
HOLI 345 503 1.03e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112629
AA Change: Y71C

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108248
Gene: ENSMUSG00000026826
AA Change: Y71C

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140165
Predicted Effect probably damaging
Transcript: ENSMUST00000183542
AA Change: Y8C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138824
Gene: ENSMUSG00000026826
AA Change: Y8C

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
Pfam:Hormone_recep 322 392 9.1e-8 PFAM
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.2%
Validation Efficiency 81% (203/250)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop dopaminergic neurons in the mesencephalon and die within the first 12 hours of life. Heterozygotes suffer from reduced motor performance in old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik T A 2: 148,785,825 *131K probably null Het
Abcb5 T A 12: 118,927,394 Q456L probably benign Het
Abcf1 A G 17: 35,958,062 probably benign Het
Adamts7 A T 9: 90,179,411 S357C probably damaging Het
Ankrd26 A G 6: 118,535,069 probably benign Het
Asb17 T A 3: 153,844,664 V111E probably damaging Het
C1qtnf4 C A 2: 90,889,549 N55K probably damaging Het
C77080 T C 4: 129,227,723 probably null Het
Cacng5 G T 11: 107,877,433 D249E probably benign Het
Camkk2 C A 5: 122,757,559 probably null Het
Ccdc27 T G 4: 154,035,738 probably benign Het
Cngb1 T A 8: 95,264,545 probably null Het
Col7a1 A G 9: 108,974,913 probably benign Het
Corin T A 5: 72,454,473 D148V possibly damaging Het
Defb26 A C 2: 152,508,068 D97E possibly damaging Het
Dgkb A G 12: 38,136,541 N237D probably benign Het
Dsp A G 13: 38,196,017 N1647S probably benign Het
Dtna G A 18: 23,621,442 A438T probably damaging Het
Erbb3 G T 10: 128,583,441 F219L probably damaging Het
EU599041 G A 7: 43,225,851 noncoding transcript Het
Fat1 A G 8: 44,953,299 N1029S probably damaging Het
Fat4 T C 3: 38,888,931 S658P probably benign Het
Fgfr2 C T 7: 130,201,075 D168N possibly damaging Het
Fstl5 T A 3: 76,659,645 probably benign Het
Glmn C T 5: 107,557,970 V451I probably benign Het
Gm8909 A T 17: 36,165,461 S304T possibly damaging Het
Gm9938 T A 19: 23,724,624 probably benign Het
Gpat2 T C 2: 127,428,249 S61P probably damaging Het
Gpr22 T A 12: 31,711,641 M6L probably benign Het
Grm5 T C 7: 88,074,977 L825P probably damaging Het
Gstz1 A T 12: 87,159,703 I66F probably benign Het
H2-T22 A G 17: 36,040,609 V243A probably damaging Het
Hivep1 C T 13: 42,156,041 L586F probably damaging Het
Hmcn2 T G 2: 31,388,344 L1686R probably damaging Het
Ice1 T C 13: 70,603,348 R1540G probably damaging Het
Igha T A 12: 113,259,927 probably benign Het
Kif3a C A 11: 53,578,985 T141K probably benign Het
Knl1 G A 2: 119,069,892 M691I probably benign Het
L3mbtl1 T C 2: 162,947,226 V13A probably benign Het
Lamc1 T A 1: 153,229,190 N1282I probably damaging Het
Lemd2 G T 17: 27,203,728 L231I probably benign Het
Lrrk2 G A 15: 91,734,009 V904M probably benign Het
Lyzl6 C T 11: 103,633,969 S103N probably benign Het
Macf1 T A 4: 123,473,868 R2367W probably damaging Het
Mapk3 T C 7: 126,759,805 Y54H probably damaging Het
Mlh3 A T 12: 85,268,818 V198D probably damaging Het
Myocd T C 11: 65,187,464 S374G possibly damaging Het
Ngef T C 1: 87,540,665 E124G probably benign Het
Nynrin T A 14: 55,863,332 V193D probably damaging Het
Olfr1280 A T 2: 111,315,904 I142F probably benign Het
Olfr1331 T A 4: 118,869,227 S148T probably benign Het
Olfr1490 G T 19: 13,654,815 V129F probably benign Het
Olfr215 A G 6: 116,582,740 S69P probably damaging Het
Olfr59 A T 11: 74,289,266 I207F probably damaging Het
Pcdh18 T C 3: 49,756,344 Y174C probably damaging Het
Pcf11 T C 7: 92,669,559 D21G possibly damaging Het
Pdia4 A C 6: 47,798,410 F489V possibly damaging Het
Pitrm1 C T 13: 6,575,032 P849S probably damaging Het
Plcz1 T C 6: 139,989,784 Y644C probably damaging Het
Ppp5c T C 7: 17,027,725 E28G probably benign Het
Prkcb A G 7: 122,590,170 Y507C probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Scarf1 A G 11: 75,515,162 probably benign Het
Scoc T A 8: 83,458,258 probably null Het
Sh2d4a A T 8: 68,282,321 M31L probably damaging Het
Spta1 T A 1: 174,207,032 probably benign Het
Stard7 A G 2: 127,292,207 Y270C probably damaging Het
Svs3b T C 2: 164,255,961 T147A probably benign Het
Tmtc3 A G 10: 100,448,961 L604P probably damaging Het
Trim30b A T 7: 104,365,895 N95K probably benign Het
Trpm8 C A 1: 88,328,148 probably benign Het
Tspan9 T C 6: 127,966,485 probably null Het
Tubgcp5 C T 7: 55,818,895 R713C probably damaging Het
Tyro3 A T 2: 119,817,006 Q872L probably damaging Het
Vmn1r204 G A 13: 22,556,209 M3I probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Wdfy3 A G 5: 101,888,105 I2149T possibly damaging Het
Wdr66 G A 5: 123,298,570 R1054H probably benign Het
Zfp668 A T 7: 127,868,038 M122K possibly damaging Het
Zkscan1 A T 5: 138,093,101 D32V probably damaging Het
Other mutations in Nr4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Nr4a2 APN 2 57109217 missense probably damaging 1.00
IGL01148:Nr4a2 APN 2 57111971 missense probably benign 0.00
IGL01395:Nr4a2 APN 2 57112153 missense probably damaging 0.98
IGL02123:Nr4a2 APN 2 57111655 missense possibly damaging 0.95
IGL02311:Nr4a2 APN 2 57111731 missense probably benign
IGL02698:Nr4a2 APN 2 57108160 missense probably damaging 1.00
IGL03178:Nr4a2 APN 2 57110766 missense probably damaging 1.00
IGL03261:Nr4a2 APN 2 57110187 missense probably benign 0.40
R0025:Nr4a2 UTSW 2 57108615 missense probably benign 0.14
R1138:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R1222:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1418:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1755:Nr4a2 UTSW 2 57109092 missense probably damaging 1.00
R2265:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2266:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2267:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2281:Nr4a2 UTSW 2 57112199 missense probably benign 0.00
R4191:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R4706:Nr4a2 UTSW 2 57112213 missense probably damaging 1.00
R4707:Nr4a2 UTSW 2 57112093 missense probably benign 0.17
R4745:Nr4a2 UTSW 2 57110151 missense probably damaging 1.00
R4924:Nr4a2 UTSW 2 57112023 missense probably benign 0.00
R5350:Nr4a2 UTSW 2 57111865 missense probably damaging 0.98
R5495:Nr4a2 UTSW 2 57112375 missense probably damaging 1.00
R6139:Nr4a2 UTSW 2 57108689 missense probably damaging 0.98
R6156:Nr4a2 UTSW 2 57112352 missense probably damaging 1.00
R6325:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
R6674:Nr4a2 UTSW 2 57112424 missense probably damaging 1.00
R6786:Nr4a2 UTSW 2 57111908 missense probably benign 0.29
R6968:Nr4a2 UTSW 2 57108746 splice site probably null
R7135:Nr4a2 UTSW 2 57112249 missense possibly damaging 0.80
R7256:Nr4a2 UTSW 2 57112369 missense probably damaging 1.00
R7495:Nr4a2 UTSW 2 57112159 missense possibly damaging 0.89
Z1088:Nr4a2 UTSW 2 57111614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTAAACCGACCCGCTGTGTG -3'
(R):5'- GAGTGTAGACCCTCAACAGCTTTCC -3'

Sequencing Primer
(F):5'- GTGGCATCATCTCCTCGGAC -3'
(R):5'- GACCAGGCTGAGTGTATATCACC -3'
Posted On2014-03-11