Incidental Mutation 'R1416:Arpp21'
ID159595
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112179129 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 101 (E101G)
Ref Sequence ENSEMBL: ENSMUSP00000123937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159055] [ENSMUST00000159246] [ENSMUST00000159451] [ENSMUST00000160478] [ENSMUST00000161097] [ENSMUST00000161412] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000162796] [ENSMUST00000164754] [ENSMUST00000172380] [ENSMUST00000178410]
Predicted Effect probably damaging
Transcript: ENSMUST00000035085
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070218
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111872
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159055
AA Change: E101G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123883
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159220
Predicted Effect probably damaging
Transcript: ENSMUST00000159246
AA Change: E101G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159444
Predicted Effect probably damaging
Transcript: ENSMUST00000159451
AA Change: E101G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125095
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 233 248 N/A INTRINSIC
low complexity region 299 319 N/A INTRINSIC
low complexity region 410 433 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159667
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000160478
SMART Domains Protein: ENSMUSP00000124550
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160741
Predicted Effect probably damaging
Transcript: ENSMUST00000161097
AA Change: E101G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123937
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161138
Predicted Effect probably damaging
Transcript: ENSMUST00000161412
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125282
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161467
Predicted Effect probably damaging
Transcript: ENSMUST00000162065
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162082
Predicted Effect probably damaging
Transcript: ENSMUST00000162097
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162533
Predicted Effect unknown
Transcript: ENSMUST00000162796
AA Change: E101G
SMART Domains Protein: ENSMUSP00000124670
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164754
AA Change: E101G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503
AA Change: E101G

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172380
SMART Domains Protein: ENSMUSP00000130558
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178410
SMART Domains Protein: ENSMUSP00000136769
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0533:Arpp21 UTSW 9 112126505 missense probably benign 0.36
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1713:Arpp21 UTSW 9 112067169 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R2932:Arpp21 UTSW 9 112179105 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R5992:Arpp21 UTSW 9 112143485 nonsense probably null
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAGTGTCCATGATAAGCAAGG -3'
(R):5'- ACTCCTGGAAGCTGTCTGTCTGTG -3'

Sequencing Primer
(F):5'- TGTCCATGATAAGCAAGGTAAGG -3'
(R):5'- ttttttttttttttttCCTGACAGGC -3'
Posted On2014-03-14