Incidental Mutation 'R1416:Stard9'
ID159568
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120700972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2570 (V2570A)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000070420
SMART Domains Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
coiled coil region 97 138 N/A INTRINSIC
low complexity region 142 151 N/A INTRINSIC
low complexity region 157 174 N/A INTRINSIC
low complexity region 234 255 N/A INTRINSIC
Pfam:START 274 469 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154193
SMART Domains Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
low complexity region 454 463 N/A INTRINSIC
low complexity region 469 486 N/A INTRINSIC
low complexity region 546 567 N/A INTRINSIC
SCOP:d1jssa_ 588 784 4e-29 SMART
Blast:START 589 785 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180041
AA Change: V2570A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: V2570A

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Meta Mutation Damage Score 0.1704 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTACCGGACTCCTCTATCAATGC -3'
(R):5'- GTCCACTTGCTCCACAAAATTGCC -3'

Sequencing Primer
(F):5'- ATCAATGCATCCATATGCCTGG -3'
(R):5'- AAATTGCCTTGGTTTACCAGTGC -3'
Posted On2014-03-14