Incidental Mutation 'R1459:Ptpdc1'
ID161991
Institutional Source Beutler Lab
Gene Symbol Ptpdc1
Ensembl Gene ENSMUSG00000038042
Gene Nameprotein tyrosine phosphatase domain containing 1
Synonyms
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R1459 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location48577872-48625664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48586697 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 419 (N419K)
Ref Sequence ENSEMBL: ENSMUSP00000152771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035824] [ENSMUST00000222028] [ENSMUST00000223025]
Predicted Effect probably benign
Transcript: ENSMUST00000035824
AA Change: N358K

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042
AA Change: N358K

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221887
Predicted Effect possibly damaging
Transcript: ENSMUST00000222028
AA Change: N419K

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000223025
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: The protein encoded by this gene is a centrosomal mitotic phosphatase. This protein has been implicated in centrosomal duplication and cytokinesis. In addition, knockdown of expression levels in non-cycling cells results in extra long cilia, suggesting that this protein may function in regulating cilia length independent of a function in cell cycle control. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc19a1 C G 10: 77,042,535 Y301* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Ptpdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Ptpdc1 APN 13 48587058 missense possibly damaging 0.80
IGL01410:Ptpdc1 APN 13 48586604 missense probably damaging 0.99
IGL02931:Ptpdc1 APN 13 48590619 splice site probably benign
IGL03180:Ptpdc1 APN 13 48586077 missense probably damaging 1.00
PIT4519001:Ptpdc1 UTSW 13 48583156 missense probably benign 0.29
PIT4687001:Ptpdc1 UTSW 13 48586290 missense probably benign 0.15
R0014:Ptpdc1 UTSW 13 48586919 nonsense probably null
R0244:Ptpdc1 UTSW 13 48585980 missense probably benign 0.00
R0420:Ptpdc1 UTSW 13 48589119 critical splice donor site probably null
R0690:Ptpdc1 UTSW 13 48586905 missense probably benign 0.33
R0946:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1076:Ptpdc1 UTSW 13 48586810 missense probably damaging 1.00
R1387:Ptpdc1 UTSW 13 48586320 missense possibly damaging 0.85
R1688:Ptpdc1 UTSW 13 48586224 missense probably benign 0.28
R1732:Ptpdc1 UTSW 13 48586545 missense probably benign 0.00
R2097:Ptpdc1 UTSW 13 48592659 critical splice acceptor site probably null
R2570:Ptpdc1 UTSW 13 48586063 missense probably benign 0.02
R3950:Ptpdc1 UTSW 13 48589194 missense probably damaging 1.00
R4260:Ptpdc1 UTSW 13 48579758 missense probably benign 0.33
R5194:Ptpdc1 UTSW 13 48586789 missense possibly damaging 0.91
R5271:Ptpdc1 UTSW 13 48590698 missense probably damaging 1.00
R5894:Ptpdc1 UTSW 13 48590322 missense probably damaging 1.00
R5934:Ptpdc1 UTSW 13 48586369 missense probably benign 0.08
R6894:Ptpdc1 UTSW 13 48590638 missense probably benign 0.21
R7056:Ptpdc1 UTSW 13 48586990 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGGTGGCATGTAGCAATGGCTC -3'
(R):5'- ATTCGCCAGCGACATCTGCTTC -3'

Sequencing Primer
(F):5'- ACTGTGGTCTAGCAACTCCTG -3'
(R):5'- GAAGATCATCCACCTGGTTTGC -3'
Posted On2014-03-14