Incidental Mutation 'R1459:Slc19a1'
ID161976
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Namesolute carrier family 19 (folate transporter), member 1
SynonymsRFC1, RFC-1, reduced folate carrier
MMRRC Submission 039514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1459 (G1)
Quality Score112
Status Validated
Chromosome10
Chromosomal Location77032241-77061002 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 77042535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 301 (Y301*)
Ref Sequence ENSEMBL: ENSMUSP00000116784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105410] [ENSMUST00000130703] [ENSMUST00000132984] [ENSMUST00000133059] [ENSMUST00000136150] [ENSMUST00000136925] [ENSMUST00000144234]
Predicted Effect probably null
Transcript: ENSMUST00000105410
AA Change: Y301*
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: Y301*

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127249
Predicted Effect probably benign
Transcript: ENSMUST00000130703
SMART Domains Protein: ENSMUSP00000115658
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 64 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131031
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132984
SMART Domains Protein: ENSMUSP00000116657
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 233 4.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133059
SMART Domains Protein: ENSMUSP00000120266
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 70 7.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136150
SMART Domains Protein: ENSMUSP00000121237
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 242 1.9e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136925
AA Change: Y301*
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436
AA Change: Y301*

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144234
AA Change: Y301*
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: Y301*

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 96% (87/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik C T 4: 62,532,341 R51W probably damaging Het
Abcb1a T A 5: 8,702,920 L557Q probably damaging Het
Abcb4 T C 5: 8,918,662 F334L possibly damaging Het
Adamts14 T A 10: 61,198,804 T1102S probably benign Het
Adamtsl1 T C 4: 86,425,865 Y1719H probably damaging Het
Adcyap1 T C 17: 93,200,122 probably null Het
Ankrd13c T A 3: 157,972,310 L219Q probably damaging Het
Ano3 C A 2: 110,880,829 A97S probably benign Het
Apaf1 T C 10: 91,062,160 N245S probably benign Het
Apob A G 12: 8,006,047 T1510A probably benign Het
Apob A G 12: 8,011,937 D3473G possibly damaging Het
Arfgap3 G A 15: 83,306,937 T12I probably benign Het
Bend4 A G 5: 67,400,075 V466A probably damaging Het
Bend7 G A 2: 4,744,428 E119K probably damaging Het
Capn5 G T 7: 98,131,842 R243S possibly damaging Het
Cd84 A G 1: 171,851,943 I63V probably benign Het
Cd86 T A 16: 36,628,988 T16S probably benign Het
Cdc42bpb A G 12: 111,296,300 probably benign Het
Cep95 C T 11: 106,817,955 S26L probably damaging Het
Cldn19 C T 4: 119,255,613 A14V probably damaging Het
Cluap1 T A 16: 3,937,589 M356K probably damaging Het
Coq7 C T 7: 118,510,037 G263S unknown Het
Ctnnd2 A C 15: 30,847,299 T679P probably damaging Het
Dnah10 A G 5: 124,743,686 D528G possibly damaging Het
Dvl1 T A 4: 155,854,019 N133K probably damaging Het
Efcab7 T G 4: 99,912,547 H550Q probably null Het
Fastkd5 C T 2: 130,614,797 M624I probably damaging Het
Fbxo42 T C 4: 141,167,762 V12A probably benign Het
Fopnl G A 16: 14,304,516 T128I possibly damaging Het
Gabarapl1 T A 6: 129,538,672 M91K possibly damaging Het
Gas7 A G 11: 67,662,076 N154S probably damaging Het
Gm21814 T A 6: 149,582,152 noncoding transcript Het
Gm6904 T A 14: 59,244,778 E175D probably damaging Het
Gnl3 G A 14: 31,017,846 R12C probably damaging Het
Golga2 T G 2: 32,297,795 probably null Het
Grk3 T A 5: 112,915,012 R656S probably benign Het
Gsap T A 5: 21,207,238 probably benign Het
H60c T C 10: 3,260,240 Q103R probably benign Het
Hnrnpr T A 4: 136,329,444 S252T probably damaging Het
Itgb4 A T 11: 115,979,111 T40S probably benign Het
Krtap27-1 T C 16: 88,671,414 N81D probably benign Het
Lilrb4a T A 10: 51,491,587 L75Q probably benign Het
Lrp2 T A 2: 69,460,477 E3546D probably damaging Het
Lrp2 T A 2: 69,483,394 D2331V probably damaging Het
Lzts2 T A 19: 45,021,454 V9E probably damaging Het
Matr3 T A 18: 35,584,656 D302E probably benign Het
Mcoln2 A G 3: 146,192,224 probably null Het
Metap2 T C 10: 93,868,949 D272G probably damaging Het
Mitf A G 6: 98,010,467 D337G probably damaging Het
Mkl2 T C 16: 13,401,569 V693A possibly damaging Het
Msh2 A G 17: 87,678,343 E116G probably benign Het
Nlrp10 T A 7: 108,924,348 M642L probably benign Het
Noxa1 G T 2: 25,092,546 Q86K probably benign Het
Nrap T C 19: 56,384,130 T48A probably benign Het
Nup160 T A 2: 90,690,150 H308Q probably damaging Het
Osbpl11 T C 16: 33,236,329 L711P probably damaging Het
Osbpl6 A G 2: 76,555,065 N281S probably benign Het
Pcnp C T 16: 56,024,340 E66K possibly damaging Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Plekhg4 T C 8: 105,381,799 L1053S probably damaging Het
Plekhh2 G T 17: 84,610,775 E1271* probably null Het
Ppp2r2b T A 18: 42,737,990 Y82F probably damaging Het
Prkd3 T C 17: 78,971,367 D430G probably damaging Het
Prl7d1 C T 13: 27,709,257 D224N possibly damaging Het
Ptpdc1 A T 13: 48,586,697 N419K possibly damaging Het
Serinc5 T A 13: 92,661,187 probably null Het
Sipa1 A G 19: 5,651,664 L981P probably damaging Het
Slc16a7 A T 10: 125,230,620 C383* probably null Het
Slc22a14 A T 9: 119,223,761 V14E possibly damaging Het
Slpi C A 2: 164,354,917 C95F probably damaging Het
Smurf2 G A 11: 106,852,507 H225Y possibly damaging Het
Son T C 16: 91,655,342 S326P possibly damaging Het
Sptb T A 12: 76,611,883 K1262M probably benign Het
Sugp2 T A 8: 70,244,064 probably benign Het
Tatdn2 T A 6: 113,710,070 H747Q probably damaging Het
Tcn2 C A 11: 3,927,516 R44L probably benign Het
Tenm3 G A 8: 48,235,971 R2194C probably damaging Het
Tnks2 T A 19: 36,845,531 probably benign Het
Top3a A T 11: 60,759,362 I120N probably damaging Het
Umodl1 T A 17: 30,982,258 probably benign Het
Umodl1 T C 17: 30,986,504 V662A probably benign Het
Ush2a T C 1: 188,862,851 S3827P probably benign Het
Vasn T A 16: 4,648,609 probably null Het
Vmn2r69 A T 7: 85,406,700 C743* probably null Het
Vmn2r79 C A 7: 87,037,794 H794Q probably benign Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0112:Slc19a1 UTSW 10 77042165 missense probably benign 0.04
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R5800:Slc19a1 UTSW 10 77042269 missense probably null 0.00
R6106:Slc19a1 UTSW 10 77044769 missense probably damaging 1.00
R6501:Slc19a1 UTSW 10 77049606 missense probably benign 0.11
R6992:Slc19a1 UTSW 10 77049706 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTGCCCTGTGAGCTGGATCAGATG -3'
(R):5'- AAGGTCACGTAGCACACCCAGATG -3'

Sequencing Primer
(F):5'- AGCTGGATCAGATGCACCC -3'
(R):5'- TGCGATGACCAGCTTGGAC -3'
Posted On2014-03-14