Incidental Mutation 'R1393:Zfp810'
List |< first << previous [record 26 of 26]
ID162699
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Namezinc finger protein 810
Synonyms
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22276748-22307648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22280514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000083459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
Predicted Effect probably benign
Transcript: ENSMUST00000086278
AA Change: D90G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829
AA Change: D90G

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214499
Predicted Effect probably benign
Transcript: ENSMUST00000215202
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cd300ld2 G A 11: 115,012,578 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 utr 3 prime probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1116:Zfp810 UTSW 9 22279085 missense probably benign 0.11
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1608:Zfp810 UTSW 9 22278920 missense probably benign 0.00
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R3684:Zfp810 UTSW 9 22278235 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7441:Zfp810 UTSW 9 22279272 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGTTATTTCCCCAGATGCCTCG -3'
(R):5'- AGCTGTCAGTGTGCAGTGTAATTCC -3'

Sequencing Primer
(F):5'- GACTTGACTGCTCAGTCTGATATTC -3'
(R):5'- CCAATTCATTGAAGACTAGGATGTGC -3'
Posted On2014-03-17