Incidental Mutation 'R1376:Olfr1124'
ID162872
Institutional Source Beutler Lab
Gene Symbol Olfr1124
Ensembl Gene ENSMUSG00000050772
Gene Nameolfactory receptor 1124
SynonymsMOR264-3, Olfr1125, GA_x6K02T2Q125-48935224-48935664, GA_x6K02T2Q125-48936945-48937901, MOR264-24
MMRRC Submission 039440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1376 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87430275-87436623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87434559 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 24 (S24L)
Ref Sequence ENSEMBL: ENSMUSP00000150244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062494] [ENSMUST00000215909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062494
AA Change: S24L

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062513
Gene: ENSMUSG00000050772
AA Change: S24L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.2e-52 PFAM
Pfam:7tm_1 47 296 2.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215909
AA Change: S24L

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 96.7%
  • 10x: 90.4%
  • 20x: 75.5%
Validation Efficiency 100% (3/3)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,363,909 I362N possibly damaging Het
9130023H24Rik A G 7: 128,237,010 V137A probably benign Het
Adal A G 2: 121,152,530 D177G probably damaging Het
AF529169 T C 9: 89,591,246 T871A probably damaging Het
Cdcp2 G T 4: 107,102,759 V124F possibly damaging Het
Ceacam3 T C 7: 17,163,163 C685R probably damaging Het
Cfd T C 10: 79,892,152 I174T possibly damaging Het
Dapk2 C G 9: 66,220,643 R68G probably damaging Het
Ehd1 C T 19: 6,294,388 T226M probably damaging Het
Elp5 A G 11: 69,975,090 V120A probably benign Het
Fam208a A G 14: 27,429,381 K105E probably benign Het
Fzd1 G A 5: 4,757,174 T136M possibly damaging Het
Galntl5 G T 5: 25,186,288 V62F probably benign Het
Josd2 C A 7: 44,471,115 P50H probably damaging Het
Lect2 T A 13: 56,542,764 I133F probably damaging Het
Lifr A G 15: 7,184,764 T700A probably benign Het
Lpl T C 8: 68,887,598 W82R probably damaging Het
Man2a1 C T 17: 64,672,043 R523C possibly damaging Het
Mast4 T C 13: 102,736,408 K1959E possibly damaging Het
Olfr1122 A G 2: 87,387,818 M38V probably benign Het
Pde4dip A G 3: 97,743,217 V963A probably damaging Het
Pdgfd A G 9: 6,376,994 I357V probably benign Het
Pold1 T C 7: 44,540,562 D400G probably damaging Het
Ppp1r12a T C 10: 108,198,918 I108T probably damaging Het
Rimbp2 G C 5: 128,770,291 P931A possibly damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Sf3b1 A T 1: 55,019,265 V55E probably damaging Het
Sult2a2 T C 7: 13,734,771 V54A probably damaging Het
Taf2 GCTTCTTCTTCTTCTTCTT GCTTCTTCTTCTTCTT 15: 55,016,461 probably benign Het
Taok3 T C 5: 117,265,961 Y734H probably damaging Het
Tuba3b A G 6: 145,618,774 E90G possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Other mutations in Olfr1124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr1124 APN 2 87435063 missense probably benign 0.00
IGL01655:Olfr1124 APN 2 87434885 missense probably damaging 1.00
IGL01878:Olfr1124 APN 2 87434970 missense possibly damaging 0.55
IGL02265:Olfr1124 APN 2 87435344 missense probably benign 0.00
IGL02379:Olfr1124 APN 2 87435324 missense probably benign 0.07
IGL02512:Olfr1124 APN 2 87435058 missense possibly damaging 0.59
IGL02578:Olfr1124 APN 2 87435057 missense probably damaging 0.96
R0617:Olfr1124 UTSW 2 87434661 missense probably damaging 1.00
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R4993:Olfr1124 UTSW 2 87435152 missense probably benign 0.00
R5045:Olfr1124 UTSW 2 87435146 missense probably damaging 1.00
R6119:Olfr1124 UTSW 2 87435389 nonsense probably null
R6146:Olfr1124 UTSW 2 87435318 missense possibly damaging 0.78
R6699:Olfr1124 UTSW 2 87434816 missense probably benign
R6883:Olfr1124 UTSW 2 87435279 missense probably damaging 0.99
R6966:Olfr1124 UTSW 2 87435279 missense probably damaging 0.98
R7383:Olfr1124 UTSW 2 87435377 missense possibly damaging 0.91
Z1088:Olfr1124 UTSW 2 87435159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTCTGCTGTCTGGAACATAGTT -3'
(R):5'- GCTCCCAGGATAAGAATGCAGCAC -3'

Sequencing Primer
(F):5'- CTGGAACATAGTTCAGAGTATACCC -3'
(R):5'- CACATTTGTGTAGCACAGGC -3'
Posted On2014-03-17