Incidental Mutation 'R1146:Mogat1'
ID165087
Institutional Source Beutler Lab
Gene Symbol Mogat1
Ensembl Gene ENSMUSG00000012187
Gene Namemonoacylglycerol O-acyltransferase 1
Synonyms1110064N14Rik, mDC2, 0610030A14Rik, Dgat2l1, MGAT1
MMRRC Submission 039219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1146 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78510991-78538173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78523613 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 105 (I105V)
Ref Sequence ENSEMBL: ENSMUSP00000116178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111]
Predicted Effect probably benign
Transcript: ENSMUST00000012331
AA Change: I105V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: I105V

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113524
AA Change: I105V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: I105V

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134947
AA Change: I105V

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: I105V

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149732
AA Change: I74V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187
AA Change: I74V

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 95.4%
  • 20x: 88.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight in female, but not, male mice and does not ameliorate hepatic steatosis in lipodystrophic or obese mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,531,676 V1848E probably damaging Het
Alpk3 A G 7: 81,077,595 K158E probably damaging Het
Arrdc4 T A 7: 68,740,008 E356D probably damaging Het
Asb4 A G 6: 5,423,591 N246S probably damaging Het
Ccdc150 A T 1: 54,364,971 probably benign Het
Ctsj G A 13: 61,002,498 P230L probably benign Het
Dync1i2 C T 2: 71,227,820 probably benign Het
Eme1 A G 11: 94,645,451 L564P probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Frg1 A G 8: 41,411,217 probably benign Het
Fzd2 A T 11: 102,605,380 S217C possibly damaging Het
Gaa G T 11: 119,274,904 R81L probably damaging Het
Gfral A G 9: 76,167,059 V368A probably benign Het
Gm10774 T C 2: 126,709,472 Y29C probably benign Het
Gucy1a2 T A 9: 3,759,830 N545K probably damaging Het
Herc2 T C 7: 56,146,696 S1939P probably benign Het
Ifnk T C 4: 35,152,231 I53T probably benign Het
Iqub G A 6: 24,505,628 L94F possibly damaging Het
Kpna1 C T 16: 36,033,379 R460* probably null Het
Masp1 T C 16: 23,492,115 E189G probably damaging Het
Mpi A G 9: 57,545,189 probably benign Het
Msh2 C A 17: 87,680,060 D209E probably benign Het
Nsf G A 11: 103,828,538 T646I probably damaging Het
Olfr1257 C T 2: 89,881,206 P127S probably damaging Het
Olfr1416 G A 1: 92,479,890 H244Y probably damaging Het
Olfr1449 T A 19: 12,934,965 S76T possibly damaging Het
Olfr980 A T 9: 40,006,094 V285D possibly damaging Het
Otogl T A 10: 107,886,513 I327F probably damaging Het
Pappa2 T C 1: 158,854,982 D832G probably damaging Het
Pax5 G T 4: 44,697,512 probably benign Het
Pfkfb4 A G 9: 109,007,726 E163G probably benign Het
Phc1 T C 6: 122,323,457 probably benign Het
Piwil1 T C 5: 128,747,893 S552P probably benign Het
Ppfia3 A C 7: 45,352,215 D424E probably benign Het
Prss16 A G 13: 22,006,968 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rbsn A G 6: 92,201,730 probably null Het
Rexo1 C T 10: 80,544,405 S919N probably benign Het
Sec31a T C 5: 100,362,173 N1152D probably damaging Het
Sel1l3 A T 5: 53,117,103 F1012I possibly damaging Het
Sema4c A G 1: 36,550,565 V539A probably benign Het
Sf3b5 A G 10: 13,008,831 E70G possibly damaging Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tor1aip2 T C 1: 156,064,737 V263A possibly damaging Het
Unc45b A G 11: 82,922,907 E380G probably damaging Het
Usp16 C T 16: 87,474,648 T364M possibly damaging Het
Wwox T C 8: 114,712,036 S281P possibly damaging Het
Zfp110 A G 7: 12,846,794 probably null Het
Zfp335 G A 2: 164,896,123 A856V probably benign Het
Zfp652 G A 11: 95,749,782 E178K possibly damaging Het
Other mutations in Mogat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0357:Mogat1 UTSW 1 78512040 missense probably benign 0.01
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1716:Mogat1 UTSW 1 78538044 missense probably benign 0.01
R3799:Mogat1 UTSW 1 78529138 missense probably benign 0.00
R4168:Mogat1 UTSW 1 78512035 missense possibly damaging 0.77
R5485:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R5929:Mogat1 UTSW 1 78523733 missense probably benign 0.00
R6640:Mogat1 UTSW 1 78523774 missense probably damaging 0.99
R6841:Mogat1 UTSW 1 78522859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATGGAGGGACCTGGGCTAAATG -3'
(R):5'- AGGGACAGTGGCTGTATCACCAAG -3'

Sequencing Primer
(F):5'- GGACCTGGGCTAAATGGATTG -3'
(R):5'- ACAGTGGCTGTGTCACTTAC -3'
Posted On2014-03-28