Incidental Mutation 'R1524:Primpol'
ID167717
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Nameprimase and polymerase (DNA-directed)
SynonymsCcdc111
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46575594-46617212 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 46586467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040468] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
Predicted Effect probably benign
Transcript: ENSMUST00000040468
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123328
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect probably benign
Transcript: ENSMUST00000209787
Predicted Effect probably benign
Transcript: ENSMUST00000211400
Meta Mutation Damage Score 0.6528 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 46581597 missense probably damaging 0.98
IGL02421:Primpol APN 8 46607795 splice site probably benign
IGL02886:Primpol APN 8 46593584 nonsense probably null
IGL03244:Primpol APN 8 46586440 missense probably damaging 1.00
R0243:Primpol UTSW 8 46599814 missense probably damaging 1.00
R0329:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0330:Primpol UTSW 8 46610461 missense probably damaging 0.97
R0571:Primpol UTSW 8 46581639 missense probably damaging 1.00
R1266:Primpol UTSW 8 46593699 missense probably damaging 1.00
R1334:Primpol UTSW 8 46586391 missense probably damaging 1.00
R1469:Primpol UTSW 8 46593637 missense probably benign
R1469:Primpol UTSW 8 46593637 missense probably benign
R1738:Primpol UTSW 8 46607838 missense probably damaging 0.98
R2144:Primpol UTSW 8 46586343 missense probably damaging 0.99
R3747:Primpol UTSW 8 46599813 missense probably benign 0.34
R3748:Primpol UTSW 8 46599813 missense probably benign 0.34
R3750:Primpol UTSW 8 46599813 missense probably benign 0.34
R4378:Primpol UTSW 8 46576183 utr 3 prime probably benign
R4855:Primpol UTSW 8 46586691 missense probably benign 0.00
R5209:Primpol UTSW 8 46590260 missense probably benign 0.00
R5497:Primpol UTSW 8 46592622 nonsense probably null
R5720:Primpol UTSW 8 46581642 missense probably damaging 1.00
R5963:Primpol UTSW 8 46593580 missense possibly damaging 0.93
R6164:Primpol UTSW 8 46586442 missense probably benign 0.10
R6497:Primpol UTSW 8 46586341 critical splice donor site probably null
R6549:Primpol UTSW 8 46605150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTAGTGCCCTTTCAAATCTACCC -3'
(R):5'- TGACATTAAAGGAGGTAAGGCTTGGCT -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- AGGTAAGGCTTGGCTTTCTCTC -3'
Posted On2014-04-13