Incidental Mutation 'R1524:Ttll5'
ID167735
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission 039565-MU
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85864568 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 233 (Y233*)
Ref Sequence ENSEMBL: ENSMUSP00000135395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably null
Transcript: ENSMUST00000040179
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040273
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095536
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110220
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 348 3.5e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110224
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155448
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176008
Predicted Effect probably null
Transcript: ENSMUST00000176695
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177114
AA Change: Y233*
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: Y233*

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- CACATGACTCCATCCTTGGAGCTG -3'
(R):5'- GTCATTTGAACCCACCCAGGTACAC -3'

Sequencing Primer
(F):5'- GGTCCATGTTACGACATCATACTG -3'
(R):5'- CACCCAGGTACACTCTGTTTC -3'
Posted On2014-04-13