Incidental Mutation 'R1498:Vmn2r6'
ID169014
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 039549-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R1498 (G1)
Quality Score203
Status Not validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64556469 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 315 (T315S)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably damaging
Transcript: ENSMUST00000165012
AA Change: T226S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: T226S

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176481
AA Change: T315S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: T315S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 97% (83/86)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,931,371 H435R probably benign Het
Acly A G 11: 100,483,801 S799P probably benign Het
Acvr1b T C 15: 101,194,010 F57S probably benign Het
Adamts5 T A 16: 85,900,102 T56S possibly damaging Het
Adrb2 T C 18: 62,178,933 T274A probably damaging Het
Agr3 A T 12: 35,934,380 probably null Het
Ankrd6 A G 4: 32,810,289 M405T probably benign Het
Aqp5 T C 15: 99,593,247 I60T probably damaging Het
Arf5 G T 6: 28,426,154 R180L probably benign Het
Asap3 A G 4: 136,239,194 N528D probably benign Het
Atmin G A 8: 116,954,801 E180K probably benign Het
Bcl11a A T 11: 24,164,005 E449D probably damaging Het
Cep128 A T 12: 91,366,417 F25I probably benign Het
Cfp GCAC GC X: 20,929,666 probably null Het
Chpt1 T A 10: 88,477,104 Y282F possibly damaging Het
Cul7 A G 17: 46,655,710 D355G probably benign Het
Daxx T C 17: 33,912,253 Y385H probably damaging Het
Dnah2 A C 11: 69,520,667 probably null Het
Dscc1 CTGAATGAAT CTGAAT 15: 55,080,176 probably benign Het
Erc2 T A 14: 28,302,898 M578K probably benign Het
Evc T A 5: 37,323,700 H267L possibly damaging Het
Exosc10 A C 4: 148,581,786 Q837P possibly damaging Het
Fasn G A 11: 120,815,419 T1033I probably damaging Het
Fat1 C A 8: 45,025,484 Y2522* probably null Het
Fbxw8 G A 5: 118,065,785 probably benign Het
Fyn A G 10: 39,532,124 D321G possibly damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm156 A G 6: 129,771,740 S105P probably damaging Het
Grm6 G A 11: 50,857,256 V398M probably damaging Het
Gtpbp1 T A 15: 79,719,021 probably null Het
Hnf1a A G 5: 114,970,537 V103A probably damaging Het
Hsp90aa1 A T 12: 110,695,688 probably null Het
Iqgap2 C T 13: 95,646,805 V1288I probably benign Het
Irx5 A G 8: 92,359,886 D199G probably damaging Het
Krt9 G T 11: 100,188,369 C732* probably null Het
Lifr T C 15: 7,190,618 S910P probably damaging Het
Lrig1 G A 6: 94,627,987 A209V possibly damaging Het
Lrrk1 T A 7: 66,302,671 R506* probably null Het
Lyst T A 13: 13,650,375 I1525K possibly damaging Het
Mad2l1 C T 6: 66,539,842 Q173* probably null Het
Mcoln1 T A 8: 3,512,861 I524N probably damaging Het
Mmp3 A T 9: 7,446,967 D49V possibly damaging Het
Morc3 A T 16: 93,853,855 N321I probably damaging Het
Mrpl48 T C 7: 100,546,488 probably benign Het
Myo6 T A 9: 80,307,679 D1231E probably damaging Het
Nlrc4 A G 17: 74,446,413 I325T probably benign Het
Olfr1079 A G 2: 86,538,558 V117A probably benign Het
Olfr1314 A T 2: 112,092,593 M36K probably benign Het
Olfr348 A T 2: 36,787,346 I274F probably damaging Het
Olfr699 T C 7: 106,790,416 Y195C possibly damaging Het
Olfr894 C G 9: 38,219,380 P183A probably damaging Het
Parvg T A 15: 84,334,631 S230T possibly damaging Het
Pcca T C 14: 122,616,818 I118T probably damaging Het
Pde6a A G 18: 61,232,860 N219S possibly damaging Het
Phldb1 G T 9: 44,701,618 P935Q possibly damaging Het
Plppr5 T C 3: 117,662,612 S261P probably damaging Het
Ppl T C 16: 5,104,765 N260S probably benign Het
Ppp1r3e A T 14: 54,876,425 H263Q probably benign Het
Ppp3cb T C 14: 20,509,499 probably null Het
Ppt2 A T 17: 34,623,101 D185E probably benign Het
Prr27 A T 5: 87,850,741 probably benign Het
Ptcd3 A T 6: 71,893,495 V327E probably damaging Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rtp1 A T 16: 23,431,220 M112L probably benign Het
Slc22a5 A T 11: 53,869,314 L392Q probably damaging Het
Slc6a7 A G 18: 60,996,692 I614T probably benign Het
Slu7 C A 11: 43,438,217 P89T possibly damaging Het
Smarcc2 T C 10: 128,482,192 V618A probably benign Het
Sorl1 C T 9: 42,041,073 R729Q probably damaging Het
Sptbn2 T C 19: 4,744,246 F1493L possibly damaging Het
Sulf1 C T 1: 12,848,350 T66I probably damaging Het
Tgtp2 A G 11: 49,059,338 Y136H probably damaging Het
Tmem117 T C 15: 94,638,361 F92S probably damaging Het
Tmprss9 T A 10: 80,895,100 V820E probably benign Het
Tpcn2 A G 7: 145,268,911 Y266H probably damaging Het
Trat1 A G 16: 48,734,941 S143P probably benign Het
Vmn1r49 T A 6: 90,072,316 R235W probably damaging Het
Vmn1r71 A T 7: 10,748,648 C38S probably benign Het
Wdr36 A G 18: 32,852,968 D575G possibly damaging Het
Zfp292 G T 4: 34,805,397 A2549E possibly damaging Het
Zfp354a A T 11: 51,070,246 H426L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp648 T A 1: 154,205,373 I426N probably damaging Het
Zfp72 T C 13: 74,372,617 N114S probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGTCCACATTGTATGGCACAG -3'
(R):5'- AGGTGGGATATGCTTCTTCCTCCTC -3'

Sequencing Primer
(F):5'- TTGGGCCAGGTACAGTTAAAAG -3'
(R):5'- CCCAGTGATAAATTCCAGTCTGAGG -3'
Posted On2014-04-13