Incidental Mutation 'R1605:Mocs2'
ID176429
Institutional Source Beutler Lab
Gene Symbol Mocs2
Ensembl Gene ENSMUSG00000015536
Gene Namemolybdenum cofactor synthesis 2
Synonyms
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114818236-114832275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114824584 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000131816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015680] [ENSMUST00000164737] [ENSMUST00000164871] [ENSMUST00000165022] [ENSMUST00000166104] [ENSMUST00000166176] [ENSMUST00000183407] [ENSMUST00000184046] [ENSMUST00000184214] [ENSMUST00000184245] [ENSMUST00000184335] [ENSMUST00000184672] [ENSMUST00000184781]
Predicted Effect probably benign
Transcript: ENSMUST00000015680
AA Change: V39A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015680
Gene: ENSMUSG00000015536
AA Change: V39A

DomainStartEndE-ValueType
Pfam:MoaE 49 161 7.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050131
Predicted Effect probably benign
Transcript: ENSMUST00000164737
AA Change: V39A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133069
Gene: ENSMUSG00000015536
AA Change: V39A

DomainStartEndE-ValueType
Pfam:MoaE 46 97 3.1e-12 PFAM
Pfam:MoaE 94 130 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164871
AA Change: V39A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131816
Gene: ENSMUSG00000015536
AA Change: V39A

DomainStartEndE-ValueType
PDB:4AP8|D 38 75 1e-14 PDB
SCOP:d1fm0e_ 44 75 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165022
SMART Domains Protein: ENSMUSP00000128965
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165669
Predicted Effect probably benign
Transcript: ENSMUST00000166104
SMART Domains Protein: ENSMUSP00000129021
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166176
AA Change: V39A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125797
Gene: ENSMUSG00000015536
AA Change: V39A

DomainStartEndE-ValueType
Pfam:MoaE 46 162 5.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170985
Predicted Effect probably benign
Transcript: ENSMUST00000183407
SMART Domains Protein: ENSMUSP00000139011
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184046
Predicted Effect probably benign
Transcript: ENSMUST00000184214
SMART Domains Protein: ENSMUSP00000139285
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184245
SMART Domains Protein: ENSMUSP00000139355
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184282
Predicted Effect probably benign
Transcript: ENSMUST00000184335
SMART Domains Protein: ENSMUSP00000139064
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184672
AA Change: V39A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139298
Gene: ENSMUSG00000015536
AA Change: V39A

DomainStartEndE-ValueType
Pfam:MoaE 46 162 5.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184781
SMART Domains Protein: ENSMUSP00000138856
Gene: ENSMUSG00000015536

DomainStartEndE-ValueType
Pfam:ThiS 9 88 1.1e-19 PFAM
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. Based on experiments with the human molybdopterin synthase ortholog, they are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice show inactivity of all molybdenum-dependent enzymes, slow weight gain, weakness, curly whiskers, hair growth and skin abnormalities, altered levels of purines, uric acid and S-sulfocysteine, bladder and kidney stone formation, increased neuronal apoptosis, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Mocs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Mocs2 UTSW 13 114824622 missense probably benign 0.02
R3881:Mocs2 UTSW 13 114819346 nonsense probably null
R3957:Mocs2 UTSW 13 114825267 critical splice donor site probably null
R4015:Mocs2 UTSW 13 114820798 splice site probably benign
R5765:Mocs2 UTSW 13 114826156 critical splice acceptor site probably null
R5781:Mocs2 UTSW 13 114820919 missense probably damaging 1.00
R6750:Mocs2 UTSW 13 114826248 missense probably damaging 0.98
R6829:Mocs2 UTSW 13 114819444 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCTTGAAGGAAAAGGCCATTCTG -3'
(R):5'- AGAGAGCACTCACTGGCTTCTACTC -3'

Sequencing Primer
(F):5'- AAGTAGAGTTCCTGTAGATTCCCG -3'
(R):5'- TGACACTTCCCCCACAGAGA -3'
Posted On2014-04-24